Mutagenetix > Incidental Mutations

Incidental Mutation 'R3030:Dytn'

264685

Institutional Source

Beutler Lab

Gene Symbol

Dytn

Ensembl Gene

ENSMUSG00000069085

Gene Name

dystrotelin

Synonyms

LOC241073

MMRRC Submission

040546-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R3030 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63622851-63686927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63633519 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 575 (E575V)

Ref Sequence

ENSEMBL: ENSMUSP00000087787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090313]

Predicted Effect

probably benign
Transcript: ENSMUST00000090313
AA Change: E575V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000087787
Gene: ENSMUSG00000069085
AA Change: E575V

Domain	Start	End	E-Value	Type
Pfam:EF-hand_2	5	118	8.2e-14	PFAM
Pfam:EF-hand_3	123	217	7.2e-20	PFAM
ZnF_ZZ	222	267	7.34e-13	SMART
coiled coil region	382	411	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,657,319	H1202Y	possibly damaging	Het
Acad8	G	T	9: 26,979,059	H287N	probably benign	Het
Aimp2	T	C	5: 143,906,691	Y27C	probably damaging	Het
Cd59a	A	T	2: 104,110,815	D46V	probably benign	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cyp4f17	T	C	17: 32,506,976	S28P	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fbln2	G	A	6: 91,233,715	E214K	probably damaging	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Helb	A	T	10: 120,089,582	C963*	probably null	Het
Hspb1	C	T	5: 135,889,413	Q205*	probably null	Het
Itpkc	G	A	7: 27,212,308		probably null	Het
Kndc1	G	T	7: 139,901,207	A70S	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nlrp2	G	A	7: 5,327,748	R550C	probably damaging	Het
Plin3	T	C	17: 56,284,184	K199E	possibly damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ppp4r4	A	G	12: 103,606,956	M705V	probably benign	Het
Slc22a3	T	C	17: 12,457,634	I291V	probably benign	Het
Smarca2	A	C	19: 26,752,029	N100T	possibly damaging	Het
Tmem260	T	C	14: 48,485,001	F331S	probably damaging	Het
Trank1	A	G	9: 111,391,530	Q2445R	possibly damaging	Het
Umod	A	G	7: 119,476,839	S235P	probably benign	Het
Vdr	T	C	15: 97,857,563	T360A	probably benign	Het
Vmn1r76	A	G	7: 11,930,475	S236P	probably damaging	Het

Other mutations in Dytn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dytn	APN	1	63678840	missense	probably benign	0.34
IGL00870:Dytn	APN	1	63677113	splice site	probably benign
IGL02110:Dytn	APN	1	63647473	missense	possibly damaging	0.86
IGL02124:Dytn	APN	1	63641092	missense	probably damaging	1.00
IGL02211:Dytn	APN	1	63674930	missense	possibly damaging	0.61
IGL02712:Dytn	APN	1	63664422	missense	probably benign	0.00
IGL02832:Dytn	APN	1	63643373	missense	probably benign	0.45
IGL03036:Dytn	APN	1	63641122	missense	probably damaging	0.97
H8562:Dytn	UTSW	1	63674912	missense	possibly damaging	0.88
R0306:Dytn	UTSW	1	63685113	missense	possibly damaging	0.89
R0441:Dytn	UTSW	1	63678774	splice site	probably benign
R1453:Dytn	UTSW	1	63633873	missense	probably damaging	0.99
R1655:Dytn	UTSW	1	63661198	missense	probably damaging	1.00
R1892:Dytn	UTSW	1	63677261	missense	probably benign	0.04
R4062:Dytn	UTSW	1	63647447	missense	probably benign	0.05
R4640:Dytn	UTSW	1	63643348	missense	possibly damaging	0.52
R4804:Dytn	UTSW	1	63643366	missense	probably benign	0.08
R4931:Dytn	UTSW	1	63633678	missense	probably benign	0.26
R5015:Dytn	UTSW	1	63633695	missense	probably benign	0.00
R5054:Dytn	UTSW	1	63661159	missense	possibly damaging	0.64
R5120:Dytn	UTSW	1	63623043	missense	probably benign
R5888:Dytn	UTSW	1	63677237	missense	possibly damaging	0.91
R6243:Dytn	UTSW	1	63647521	missense	possibly damaging	0.76
R6400:Dytn	UTSW	1	63641176	nonsense	probably null
R7595:Dytn	UTSW	1	63659002	missense	probably damaging	0.99
R7705:Dytn	UTSW	1	63678789	missense	probably damaging	1.00
Z1177:Dytn	UTSW	1	63633454	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTCTGAAAGTCTTACCTGAC -3'
(R):5'- GGGAAAGCTCTACCAGACTCTG -3'

Sequencing Primer
(F):5'- GTCTATATAGGCAGTTCCAGGCC -3'
(R):5'- CTCTGAACCACAAGAGATCATTTTGC -3'

Posted On

2015-02-05