Incidental Mutation 'R3030:Dytn'
ID264685
Institutional Source Beutler Lab
Gene Symbol Dytn
Ensembl Gene ENSMUSG00000069085
Gene Namedystrotelin
SynonymsLOC241073
MMRRC Submission 040546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3030 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63622851-63686927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63633519 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 575 (E575V)
Ref Sequence ENSEMBL: ENSMUSP00000087787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090313]
Predicted Effect probably benign
Transcript: ENSMUST00000090313
AA Change: E575V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087787
Gene: ENSMUSG00000069085
AA Change: E575V

DomainStartEndE-ValueType
Pfam:EF-hand_2 5 118 8.2e-14 PFAM
Pfam:EF-hand_3 123 217 7.2e-20 PFAM
ZnF_ZZ 222 267 7.34e-13 SMART
coiled coil region 382 411 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,657,319 H1202Y possibly damaging Het
Acad8 G T 9: 26,979,059 H287N probably benign Het
Aimp2 T C 5: 143,906,691 Y27C probably damaging Het
Cd59a A T 2: 104,110,815 D46V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbln2 G A 6: 91,233,715 E214K probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Helb A T 10: 120,089,582 C963* probably null Het
Hspb1 C T 5: 135,889,413 Q205* probably null Het
Itpkc G A 7: 27,212,308 probably null Het
Kndc1 G T 7: 139,901,207 A70S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp2 G A 7: 5,327,748 R550C probably damaging Het
Plin3 T C 17: 56,284,184 K199E possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp4r4 A G 12: 103,606,956 M705V probably benign Het
Slc22a3 T C 17: 12,457,634 I291V probably benign Het
Smarca2 A C 19: 26,752,029 N100T possibly damaging Het
Tmem260 T C 14: 48,485,001 F331S probably damaging Het
Trank1 A G 9: 111,391,530 Q2445R possibly damaging Het
Umod A G 7: 119,476,839 S235P probably benign Het
Vdr T C 15: 97,857,563 T360A probably benign Het
Vmn1r76 A G 7: 11,930,475 S236P probably damaging Het
Other mutations in Dytn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dytn APN 1 63678840 missense probably benign 0.34
IGL00870:Dytn APN 1 63677113 splice site probably benign
IGL02110:Dytn APN 1 63647473 missense possibly damaging 0.86
IGL02124:Dytn APN 1 63641092 missense probably damaging 1.00
IGL02211:Dytn APN 1 63674930 missense possibly damaging 0.61
IGL02712:Dytn APN 1 63664422 missense probably benign 0.00
IGL02832:Dytn APN 1 63643373 missense probably benign 0.45
IGL03036:Dytn APN 1 63641122 missense probably damaging 0.97
H8562:Dytn UTSW 1 63674912 missense possibly damaging 0.88
R0306:Dytn UTSW 1 63685113 missense possibly damaging 0.89
R0441:Dytn UTSW 1 63678774 splice site probably benign
R1453:Dytn UTSW 1 63633873 missense probably damaging 0.99
R1655:Dytn UTSW 1 63661198 missense probably damaging 1.00
R1892:Dytn UTSW 1 63677261 missense probably benign 0.04
R4062:Dytn UTSW 1 63647447 missense probably benign 0.05
R4640:Dytn UTSW 1 63643348 missense possibly damaging 0.52
R4804:Dytn UTSW 1 63643366 missense probably benign 0.08
R4931:Dytn UTSW 1 63633678 missense probably benign 0.26
R5015:Dytn UTSW 1 63633695 missense probably benign 0.00
R5054:Dytn UTSW 1 63661159 missense possibly damaging 0.64
R5120:Dytn UTSW 1 63623043 missense probably benign
R5888:Dytn UTSW 1 63677237 missense possibly damaging 0.91
R6243:Dytn UTSW 1 63647521 missense possibly damaging 0.76
R6400:Dytn UTSW 1 63641176 nonsense probably null
R7595:Dytn UTSW 1 63659002 missense probably damaging 0.99
R7705:Dytn UTSW 1 63678789 missense probably damaging 1.00
Z1177:Dytn UTSW 1 63633454 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTCTGAAAGTCTTACCTGAC -3'
(R):5'- GGGAAAGCTCTACCAGACTCTG -3'

Sequencing Primer
(F):5'- GTCTATATAGGCAGTTCCAGGCC -3'
(R):5'- CTCTGAACCACAAGAGATCATTTTGC -3'
Posted On2015-02-05