Incidental Mutation 'R3030:Itpkc'
ID 264694
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Name inositol 1,4,5-trisphosphate 3-kinase C
Synonyms
MMRRC Submission 040546-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R3030 (G1)
Quality Score 203
Status Not validated
Chromosome 7
Chromosomal Location 27207172-27228661 bp(-) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) G to A at 27212308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850] [ENSMUST00000108379]
AlphaFold Q7TS72
Predicted Effect probably null
Transcript: ENSMUST00000003850
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108379
SMART Domains Protein: ENSMUSP00000104016
Gene: ENSMUSG00000078786

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149067
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,657,319 H1202Y possibly damaging Het
Acad8 G T 9: 26,979,059 H287N probably benign Het
Aimp2 T C 5: 143,906,691 Y27C probably damaging Het
Cd59a A T 2: 104,110,815 D46V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Dytn T A 1: 63,633,519 E575V probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbln2 G A 6: 91,233,715 E214K probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Helb A T 10: 120,089,582 C963* probably null Het
Hspb1 C T 5: 135,889,413 Q205* probably null Het
Kndc1 G T 7: 139,901,207 A70S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp2 G A 7: 5,327,748 R550C probably damaging Het
Plin3 T C 17: 56,284,184 K199E possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp4r4 A G 12: 103,606,956 M705V probably benign Het
Slc22a3 T C 17: 12,457,634 I291V probably benign Het
Smarca2 A C 19: 26,752,029 N100T possibly damaging Het
Tmem260 T C 14: 48,485,001 F331S probably damaging Het
Trank1 A G 9: 111,391,530 Q2445R possibly damaging Het
Umod A G 7: 119,476,839 S235P probably benign Het
Vdr T C 15: 97,857,563 T360A probably benign Het
Vmn1r76 A G 7: 11,930,475 S236P probably damaging Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3851:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3852:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3916:Itpkc UTSW 7 27228303 missense probably benign 0.09
R3963:Itpkc UTSW 7 27227509 missense probably damaging 1.00
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R7379:Itpkc UTSW 7 27227769 missense probably benign 0.12
R8305:Itpkc UTSW 7 27214519 missense probably damaging 1.00
R8365:Itpkc UTSW 7 27212352 missense probably damaging 1.00
R9216:Itpkc UTSW 7 27228004 missense probably benign 0.19
R9634:Itpkc UTSW 7 27214455 missense probably benign 0.29
R9764:Itpkc UTSW 7 27227797 missense probably benign 0.00
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTTTTGAATCCCAGCCCTG -3'
(R):5'- GGTGGGAATGGATTCATGTAACC -3'

Sequencing Primer
(F):5'- CAGCCCTGGAAATAAAAAGAGAAAAC -3'
(R):5'- GGAATGGATTCATGTAACCTGTCTC -3'
Posted On 2015-02-05