Incidental Mutation 'R3030:Tmem260'
ID 264705
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
MMRRC Submission 040546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3030 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48485001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 331 (F331S)
Ref Sequence ENSEMBL: ENSMUSP00000154360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226422] [ENSMUST00000227440] [ENSMUST00000228697]
AlphaFold Q8BMD6
Predicted Effect possibly damaging
Transcript: ENSMUST00000111735
AA Change: F331S

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: F331S

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124720
AA Change: F179S

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339
AA Change: F179S

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133744
Predicted Effect probably benign
Transcript: ENSMUST00000153765
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226373
Predicted Effect possibly damaging
Transcript: ENSMUST00000226422
AA Change: F331S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000227440
AA Change: F331S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228697
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,657,319 H1202Y possibly damaging Het
Acad8 G T 9: 26,979,059 H287N probably benign Het
Aimp2 T C 5: 143,906,691 Y27C probably damaging Het
Cd59a A T 2: 104,110,815 D46V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Dytn T A 1: 63,633,519 E575V probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbln2 G A 6: 91,233,715 E214K probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Helb A T 10: 120,089,582 C963* probably null Het
Hspb1 C T 5: 135,889,413 Q205* probably null Het
Itpkc G A 7: 27,212,308 probably null Het
Kndc1 G T 7: 139,901,207 A70S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp2 G A 7: 5,327,748 R550C probably damaging Het
Plin3 T C 17: 56,284,184 K199E possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp4r4 A G 12: 103,606,956 M705V probably benign Het
Slc22a3 T C 17: 12,457,634 I291V probably benign Het
Smarca2 A C 19: 26,752,029 N100T possibly damaging Het
Trank1 A G 9: 111,391,530 Q2445R possibly damaging Het
Umod A G 7: 119,476,839 S235P probably benign Het
Vdr T C 15: 97,857,563 T360A probably benign Het
Vmn1r76 A G 7: 11,930,475 S236P probably damaging Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 splice site probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R8795:Tmem260 UTSW 14 48451913 missense probably damaging 1.00
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9056:Tmem260 UTSW 14 48480317 missense probably benign
R9096:Tmem260 UTSW 14 48520346 missense unknown
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGCAGAGATTTTGCTCT -3'
(R):5'- TCACTGGGGTTATGTGCATATATGA -3'

Sequencing Primer
(F):5'- GCTGCAGAGATTTTGCTCTTTCTTC -3'
(R):5'- ATTCACTGGGGTTATGTGTAATTATG -3'
Posted On 2015-02-05