Incidental Mutation 'R3030:Vdr'
ID264706
Institutional Source Beutler Lab
Gene Symbol Vdr
Ensembl Gene ENSMUSG00000022479
Gene Namevitamin D (1,25-dihydroxyvitamin D3) receptor
SynonymsNr1i1
MMRRC Submission 040546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3030 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97854425-97910630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97857563 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 360 (T360A)
Ref Sequence ENSEMBL: ENSMUSP00000023119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023119]
Predicted Effect probably benign
Transcript: ENSMUST00000023119
AA Change: T360A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: T360A

DomainStartEndE-ValueType
ZnF_C4 21 92 1.4e-34 SMART
low complexity region 102 114 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
HOLI 227 389 3.54e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,657,319 H1202Y possibly damaging Het
Acad8 G T 9: 26,979,059 H287N probably benign Het
Aimp2 T C 5: 143,906,691 Y27C probably damaging Het
Cd59a A T 2: 104,110,815 D46V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Dytn T A 1: 63,633,519 E575V probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbln2 G A 6: 91,233,715 E214K probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Helb A T 10: 120,089,582 C963* probably null Het
Hspb1 C T 5: 135,889,413 Q205* probably null Het
Itpkc G A 7: 27,212,308 probably null Het
Kndc1 G T 7: 139,901,207 A70S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp2 G A 7: 5,327,748 R550C probably damaging Het
Plin3 T C 17: 56,284,184 K199E possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp4r4 A G 12: 103,606,956 M705V probably benign Het
Slc22a3 T C 17: 12,457,634 I291V probably benign Het
Smarca2 A C 19: 26,752,029 N100T possibly damaging Het
Tmem260 T C 14: 48,485,001 F331S probably damaging Het
Trank1 A G 9: 111,391,530 Q2445R possibly damaging Het
Umod A G 7: 119,476,839 S235P probably benign Het
Vmn1r76 A G 7: 11,930,475 S236P probably damaging Het
Other mutations in Vdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Vdr APN 15 97884854 missense probably damaging 1.00
IGL02813:Vdr APN 15 97869681 missense probably benign 0.45
yangshuo UTSW 15 97859121 missense probably damaging 1.00
R0400:Vdr UTSW 15 97869351 missense probably benign 0.00
R1102:Vdr UTSW 15 97859121 missense probably damaging 1.00
R1172:Vdr UTSW 15 97869333 missense probably benign 0.05
R1173:Vdr UTSW 15 97869333 missense probably benign 0.05
R1268:Vdr UTSW 15 97857475 missense probably benign 0.39
R1705:Vdr UTSW 15 97867171 missense probably damaging 1.00
R2879:Vdr UTSW 15 97859127 missense probably benign 0.01
R4695:Vdr UTSW 15 97858920 splice site probably null
R5074:Vdr UTSW 15 97857578 missense probably benign 0.35
R5710:Vdr UTSW 15 97859127 missense probably damaging 1.00
R5710:Vdr UTSW 15 97867208 missense probably benign 0.02
R5845:Vdr UTSW 15 97869766 missense possibly damaging 0.46
R5982:Vdr UTSW 15 97857596 missense probably benign 0.37
R6776:Vdr UTSW 15 97869828 missense probably damaging 1.00
R6865:Vdr UTSW 15 97857505 missense probably damaging 1.00
R7870:Vdr UTSW 15 97884890 missense possibly damaging 0.59
R7953:Vdr UTSW 15 97884890 missense possibly damaging 0.59
X0023:Vdr UTSW 15 97869818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCAGGAGATCTCATTGC -3'
(R):5'- TGAGCCCAGGAAAGGACTTG -3'

Sequencing Primer
(F):5'- GTCAGGAGATCTCATTGCCGAAC -3'
(R):5'- ACTTGGTCCTAAATGCAGGG -3'
Posted On2015-02-05