Incidental Mutation 'R3030:Slc22a3'
ID264709
Institutional Source Beutler Lab
Gene Symbol Slc22a3
Ensembl Gene ENSMUSG00000023828
Gene Namesolute carrier family 22 (organic cation transporter), member 3
SynonymsOct3, EMT, Orct3
MMRRC Submission 040546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3030 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12419972-12507704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12457634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 291 (I291V)
Ref Sequence ENSEMBL: ENSMUSP00000024595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024595]
Predicted Effect probably benign
Transcript: ENSMUST00000024595
AA Change: I291V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024595
Gene: ENSMUSG00000023828
AA Change: I291V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 105 526 1.2e-28 PFAM
Pfam:MFS_1 144 395 3.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to paraquat-induced dopamine neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,657,319 H1202Y possibly damaging Het
Acad8 G T 9: 26,979,059 H287N probably benign Het
Aimp2 T C 5: 143,906,691 Y27C probably damaging Het
Cd59a A T 2: 104,110,815 D46V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Dytn T A 1: 63,633,519 E575V probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbln2 G A 6: 91,233,715 E214K probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Helb A T 10: 120,089,582 C963* probably null Het
Hspb1 C T 5: 135,889,413 Q205* probably null Het
Itpkc G A 7: 27,212,308 probably null Het
Kndc1 G T 7: 139,901,207 A70S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp2 G A 7: 5,327,748 R550C probably damaging Het
Plin3 T C 17: 56,284,184 K199E possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp4r4 A G 12: 103,606,956 M705V probably benign Het
Smarca2 A C 19: 26,752,029 N100T possibly damaging Het
Tmem260 T C 14: 48,485,001 F331S probably damaging Het
Trank1 A G 9: 111,391,530 Q2445R possibly damaging Het
Umod A G 7: 119,476,839 S235P probably benign Het
Vdr T C 15: 97,857,563 T360A probably benign Het
Vmn1r76 A G 7: 11,930,475 S236P probably damaging Het
Other mutations in Slc22a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Slc22a3 APN 17 12425610 missense probably damaging 1.00
IGL01343:Slc22a3 APN 17 12425629 missense probably damaging 1.00
IGL01621:Slc22a3 APN 17 12458492 missense probably benign 0.02
IGL02228:Slc22a3 APN 17 12459810 missense probably damaging 1.00
R0466:Slc22a3 UTSW 17 12458493 nonsense probably null
R1501:Slc22a3 UTSW 17 12507104 missense probably benign 0.12
R1688:Slc22a3 UTSW 17 12433807 missense probably damaging 1.00
R4604:Slc22a3 UTSW 17 12459771 missense probably benign 0.38
R4754:Slc22a3 UTSW 17 12507195 missense probably benign 0.03
R4796:Slc22a3 UTSW 17 12423788 missense probably damaging 1.00
R4865:Slc22a3 UTSW 17 12464532 missense probably benign 0.03
R5433:Slc22a3 UTSW 17 12458490 missense probably damaging 1.00
R5483:Slc22a3 UTSW 17 12464467 missense probably damaging 0.99
R5719:Slc22a3 UTSW 17 12423804 missense probably damaging 1.00
R5750:Slc22a3 UTSW 17 12433508 missense probably benign 0.01
R5872:Slc22a3 UTSW 17 12433468 missense probably damaging 1.00
R5988:Slc22a3 UTSW 17 12433895 missense possibly damaging 0.92
R6197:Slc22a3 UTSW 17 12458551 missense probably benign 0.00
R7155:Slc22a3 UTSW 17 12433631 missense possibly damaging 0.83
R7764:Slc22a3 UTSW 17 12458496 missense probably damaging 1.00
R7775:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
R7824:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
X0027:Slc22a3 UTSW 17 12458471 missense possibly damaging 0.91
Z1088:Slc22a3 UTSW 17 12425681 nonsense probably null
Z1177:Slc22a3 UTSW 17 12507058 missense probably benign
Z1177:Slc22a3 UTSW 17 12507171 missense probably damaging 1.00
Z1177:Slc22a3 UTSW 17 12507175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTAAAACTGGTCCAGGCC -3'
(R):5'- GACTGTAGGATTCCCTGATCTTG -3'

Sequencing Primer
(F):5'- CTAAAACTGGTCCAGGCCAATGTG -3'
(R):5'- GGATTCCCTGATCTTGCAAAAAC -3'
Posted On2015-02-05