Incidental Mutation 'R3031:Zfp663'
ID264717
Institutional Source Beutler Lab
Gene Symbol Zfp663
Ensembl Gene ENSMUSG00000056824
Gene Namezinc finger protein 663
SynonymsGm1008, LOC381405
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165351297-165368729 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 165353696 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 201 (L201*)
Ref Sequence ENSEMBL: ENSMUSP00000099374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073062] [ENSMUST00000103085] [ENSMUST00000141140]
Predicted Effect probably null
Transcript: ENSMUST00000073062
AA Change: L201*
SMART Domains Protein: ENSMUSP00000072813
Gene: ENSMUSG00000056824
AA Change: L201*

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103085
AA Change: L201*
SMART Domains Protein: ENSMUSP00000099374
Gene: ENSMUSG00000056824
AA Change: L201*

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136482
Predicted Effect probably benign
Transcript: ENSMUST00000141140
SMART Domains Protein: ENSMUSP00000115254
Gene: ENSMUSG00000056824

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Other mutations in Zfp663
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Zfp663 APN 2 165352605 missense probably damaging 1.00
IGL01382:Zfp663 APN 2 165359015 missense probably damaging 1.00
IGL02007:Zfp663 APN 2 165359073 missense probably benign 0.12
IGL02164:Zfp663 APN 2 165359048 nonsense probably null
IGL02506:Zfp663 APN 2 165353951 missense probably benign 0.35
IGL03173:Zfp663 APN 2 165352499 missense probably damaging 0.99
R0735:Zfp663 UTSW 2 165359075 missense probably damaging 0.97
R1395:Zfp663 UTSW 2 165352572 missense probably damaging 1.00
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1503:Zfp663 UTSW 2 165352653 missense probably damaging 0.99
R1587:Zfp663 UTSW 2 165353517 missense probably benign
R1854:Zfp663 UTSW 2 165353291 missense probably benign 0.18
R1867:Zfp663 UTSW 2 165352731 missense possibly damaging 0.74
R4643:Zfp663 UTSW 2 165353005 missense probably benign 0.24
R4691:Zfp663 UTSW 2 165359130 intron probably benign
R4977:Zfp663 UTSW 2 165353811 missense probably damaging 0.97
R5135:Zfp663 UTSW 2 165353670 missense possibly damaging 0.95
R5151:Zfp663 UTSW 2 165353193 missense probably benign 0.00
R5639:Zfp663 UTSW 2 165353009 missense probably benign 0.03
R5763:Zfp663 UTSW 2 165358435 nonsense probably null
R6776:Zfp663 UTSW 2 165359015 missense probably damaging 1.00
R6929:Zfp663 UTSW 2 165353258 missense probably benign
R6998:Zfp663 UTSW 2 165354002 missense possibly damaging 0.74
R7035:Zfp663 UTSW 2 165353103 missense probably benign 0.36
R7169:Zfp663 UTSW 2 165352439 missense probably benign 0.00
R7529:Zfp663 UTSW 2 165352808 missense probably damaging 1.00
R7790:Zfp663 UTSW 2 165352533 missense probably damaging 1.00
R8087:Zfp663 UTSW 2 165353759 missense probably benign 0.20
R8715:Zfp663 UTSW 2 165352724 missense probably damaging 1.00
R8934:Zfp663 UTSW 2 165352794 missense probably damaging 1.00
RF004:Zfp663 UTSW 2 165358443 missense probably benign 0.00
Z1177:Zfp663 UTSW 2 165353113 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGTTGGCTAGCCTCTTG -3'
(R):5'- CAGAAGTGTTGCTCAATGGAAGC -3'

Sequencing Primer
(F):5'- GCTTCTTCCTTTCACGTAGGG -3'
(R):5'- TTGCTCAATGGAAGCAAGCTTG -3'
Posted On2015-02-05