Incidental Mutation 'R3031:Cbln4'
ID264719
Institutional Source Beutler Lab
Gene Symbol Cbln4
Ensembl Gene ENSMUSG00000067578
Gene Namecerebellin 4 precursor protein
Synonyms
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location172036233-172043466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172042180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000085263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087950]
Predicted Effect probably damaging
Transcript: ENSMUST00000087950
AA Change: V40A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085263
Gene: ENSMUSG00000067578
AA Change: V40A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
C1Q 61 198 1.14e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137886
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of small secreted proteins containing C1Q domains. Members of this family are involved in regulation of neurexin signalling during synapse development. The mouse homolog of the protein encoded by this gene competes with netrin to bind to the deleted in colorectal cancer receptor. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Cbln4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cbln4 APN 2 172039050 missense probably benign 0.44
IGL02156:Cbln4 APN 2 172042208 missense probably benign 0.24
R1035:Cbln4 UTSW 2 172042069 missense possibly damaging 0.78
R1352:Cbln4 UTSW 2 172037456 missense possibly damaging 0.89
R4013:Cbln4 UTSW 2 172037557 missense probably damaging 0.98
R4881:Cbln4 UTSW 2 172042139 missense possibly damaging 0.78
R4934:Cbln4 UTSW 2 172038981 missense probably damaging 1.00
R6084:Cbln4 UTSW 2 172042096 missense probably damaging 1.00
R7138:Cbln4 UTSW 2 172042175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGTCTGACCTGATCAAAG -3'
(R):5'- TCAGTCCTGAGAATTGGTGGAAG -3'

Sequencing Primer
(F):5'- CCTGATCAAAGTAAATGATGCGAGTC -3'
(R):5'- TGCAGCGCTGTCGATCTAG -3'
Posted On2015-02-05