Incidental Mutation 'R3031:Gkn3'
ID264721
Institutional Source Beutler Lab
Gene Symbol Gkn3
Ensembl Gene ENSMUSG00000030048
Gene Namegastrokine 3
Synonyms
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3031 (G1)
Quality Score185
Status Not validated
Chromosome6
Chromosomal Location87383256-87388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87383525 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000032127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032127] [ENSMUST00000032128]
Predicted Effect probably damaging
Transcript: ENSMUST00000032127
AA Change: A163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032127
Gene: ENSMUSG00000030048
AA Change: A163T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BRICHOS 63 155 1.47e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032128
SMART Domains Protein: ENSMUSP00000032128
Gene: ENSMUSG00000030049

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BRICHOS 54 151 6.63e-34 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Gkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Gkn3 APN 6 87383511 missense possibly damaging 0.70
IGL02746:Gkn3 APN 6 87387357 splice site probably benign
IGL03345:Gkn3 APN 6 87388816 missense probably null 0.09
R1758:Gkn3 UTSW 6 87388835 start codon destroyed probably benign
R2303:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2304:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2363:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2365:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2897:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2898:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2983:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3426:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3433:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4085:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4086:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4087:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4088:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4089:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4090:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4164:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4720:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4721:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4722:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4723:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4766:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4941:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5004:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6078:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6079:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6502:Gkn3 UTSW 6 87388804 missense probably benign 0.01
R6924:Gkn3 UTSW 6 87388802 missense probably benign 0.05
R7695:Gkn3 UTSW 6 87384440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGGGAAGCCAACATGTG -3'
(R):5'- TTCTTCAAGACACAAGGGTCC -3'

Sequencing Primer
(F):5'- TGTGGAGCACAGAGGACTGC -3'
(R):5'- CACACTGGGCTAAGGGGTTAC -3'
Posted On2015-02-05