Incidental Mutation 'R3031:Cdc37'
ID264727
Institutional Source Beutler Lab
Gene Symbol Cdc37
Ensembl Gene ENSMUSG00000019471
Gene Namecell division cycle 37
Synonymsp50Cdc37
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3031 (G1)
Quality Score123
Status Not validated
Chromosome9
Chromosomal Location21133222-21149982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21143191 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 46 (E46G)
Ref Sequence ENSEMBL: ENSMUSP00000019615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019615] [ENSMUST00000215296]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019615
AA Change: E46G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019615
Gene: ENSMUSG00000019471
AA Change: E46G

DomainStartEndE-ValueType
CDC37_N 1 128 1.07e-69 SMART
CDC37_M 121 283 4.37e-84 SMART
CDC37_C 287 379 1.25e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000215296
AA Change: E46G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215866
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Cdc 37, a cell division cycle control protein of Sacchromyces cerevisiae. This protein is a molecular chaperone with specific function in cell signal transduction. It has been shown to form complex with Hsp90 and a variety of protein kinases including CDK4, CDK6, SRC, RAF-1, MOK, as well as eIF2 alpha kinases. It is thought to play a critical role in directing Hsp90 to its target kinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Cdc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Cdc37 APN 9 21143113 missense probably benign 0.00
IGL02448:Cdc37 APN 9 21139851 missense possibly damaging 0.55
IGL02547:Cdc37 APN 9 21139966 unclassified probably benign
R0137:Cdc37 UTSW 9 21142130 missense possibly damaging 0.74
R0195:Cdc37 UTSW 9 21142280 missense probably benign 0.01
R0523:Cdc37 UTSW 9 21142996 missense probably damaging 1.00
R0611:Cdc37 UTSW 9 21142241 missense probably damaging 1.00
R0629:Cdc37 UTSW 9 21140768 missense possibly damaging 0.72
R0755:Cdc37 UTSW 9 21139864 missense probably damaging 1.00
R1512:Cdc37 UTSW 9 21142416 splice site probably benign
R2127:Cdc37 UTSW 9 21149847 missense probably damaging 1.00
R2238:Cdc37 UTSW 9 21142533 nonsense probably null
R2239:Cdc37 UTSW 9 21142533 nonsense probably null
R5068:Cdc37 UTSW 9 21149803 missense probably damaging 0.98
R5169:Cdc37 UTSW 9 21141117 missense probably benign 0.00
R5308:Cdc37 UTSW 9 21140764 missense probably benign 0.00
R5333:Cdc37 UTSW 9 21143161 missense possibly damaging 0.69
R5595:Cdc37 UTSW 9 21143213 missense probably damaging 1.00
R7040:Cdc37 UTSW 9 21142223 missense probably damaging 1.00
R7819:Cdc37 UTSW 9 21140964 missense probably damaging 0.97
R8066:Cdc37 UTSW 9 21143141 missense probably benign 0.01
R8500:Cdc37 UTSW 9 21140801 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACATTCCAGGGCATGTTC -3'
(R):5'- CATAGACATGTGGCAGCAGG -3'

Sequencing Primer
(F):5'- TGCGCATGTCTTCCAGC -3'
(R):5'- CTGTGTGCTCTGTAGTCAG -3'
Posted On2015-02-05