Incidental Mutation 'R3031:Sult3a1'
ID264731
Institutional Source Beutler Lab
Gene Symbol Sult3a1
Ensembl Gene ENSMUSG00000069668
Gene Namesulfotransferase family 3A, member 1
SynonymsSultx2
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location33857721-33879532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33877349 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 214 (D214N)
Ref Sequence ENSEMBL: ENSMUSP00000151228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092597] [ENSMUST00000218204]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092597
AA Change: D214N

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090259
Gene: ENSMUSG00000069668
AA Change: D214N

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 36 283 1.8e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217760
Predicted Effect possibly damaging
Transcript: ENSMUST00000218204
AA Change: D214N

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Sult3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Sult3a1 APN 10 33879209 nonsense probably null
IGL02269:Sult3a1 APN 10 33879263 missense probably benign 0.25
IGL02302:Sult3a1 APN 10 33866575 missense possibly damaging 0.81
IGL02947:Sult3a1 APN 10 33864050 missense possibly damaging 0.92
IGL02966:Sult3a1 APN 10 33877273 splice site probably benign
IGL03271:Sult3a1 APN 10 33864001 missense probably benign
IGL03367:Sult3a1 APN 10 33877346 missense probably benign 0.01
R0539:Sult3a1 UTSW 10 33866523 missense probably damaging 1.00
R0627:Sult3a1 UTSW 10 33864014 missense probably benign 0.00
R0838:Sult3a1 UTSW 10 33879288 missense probably damaging 0.99
R1538:Sult3a1 UTSW 10 33870170 missense probably benign 0.29
R1604:Sult3a1 UTSW 10 33866620 missense probably damaging 1.00
R1622:Sult3a1 UTSW 10 33870250 missense probably benign 0.39
R4933:Sult3a1 UTSW 10 33866554 missense probably damaging 1.00
R5943:Sult3a1 UTSW 10 33866641 missense probably damaging 0.99
R6440:Sult3a1 UTSW 10 33870202 missense possibly damaging 0.46
R7140:Sult3a1 UTSW 10 33877287 missense probably damaging 1.00
R7356:Sult3a1 UTSW 10 33866583 missense probably benign 0.25
R8342:Sult3a1 UTSW 10 33866521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCCTATTCTGTATCAATGCC -3'
(R):5'- TTGGCCTGAGTATAAGCACGC -3'

Sequencing Primer
(F):5'- CACCCTGCTTCTGTGAATAAATG -3'
(R):5'- GCGAAGGAAACTTCCCAT -3'
Posted On2015-02-05