Incidental Mutation 'R3031:Abcc5'
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission 040547-MU
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20375113 bp
Amino Acid Change Valine to Leucine at position 753 (V753L)
Ref Sequence ENSEMBL: ENSMUSP00000111209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547] [ENSMUST00000232044]
Predicted Effect probably damaging
Transcript: ENSMUST00000079158
AA Change: V753L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: V753L

Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115547
AA Change: V753L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: V753L

Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150340
Predicted Effect probably benign
Transcript: ENSMUST00000232044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 splice site probably null
R4433:Abcc5 UTSW 16 20368187 splice site probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
R7167:Abcc5 UTSW 16 20405501 missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20376508 splice site probably null
R7318:Abcc5 UTSW 16 20392543 missense probably benign 0.01
R7380:Abcc5 UTSW 16 20397034 missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20422423 missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20375070 missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20399989 missense probably benign 0.04
R7567:Abcc5 UTSW 16 20405510 missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20375132 nonsense probably null
R7623:Abcc5 UTSW 16 20344696 missense possibly damaging 0.95
R7682:Abcc5 UTSW 16 20368053 missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20365723 missense probably damaging 0.98
R8327:Abcc5 UTSW 16 20422318 missense probably benign 0.00
R8518:Abcc5 UTSW 16 20404648 missense possibly damaging 0.80
R8678:Abcc5 UTSW 16 20365935 missense probably benign 0.31
R8679:Abcc5 UTSW 16 20333729 missense possibly damaging 0.89
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-02-05