Incidental Mutation 'R3031:Dsg1a'
ID264742
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Namedesmoglein 1 alpha
SynonymsDsg1
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20310811-20343350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20340492 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 874 (D874V)
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
Predicted Effect probably damaging
Transcript: ENSMUST00000077146
AA Change: D874V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: D874V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
PIT4687001:Dsg1a UTSW 18 20331698 missense probably benign 0.16
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R1980:Dsg1a UTSW 18 20338650 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R2426:Dsg1a UTSW 18 20336804 missense probably damaging 0.96
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
R7018:Dsg1a UTSW 18 20328738 missense possibly damaging 0.48
R7201:Dsg1a UTSW 18 20328311 missense probably damaging 0.98
R7730:Dsg1a UTSW 18 20331711 missense possibly damaging 0.77
R7814:Dsg1a UTSW 18 20338515 intron probably null
R8185:Dsg1a UTSW 18 20340612 missense probably damaging 1.00
R8297:Dsg1a UTSW 18 20332033 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCCCACATTTTGGCACGAC -3'
(R):5'- TGCCTATCATGCCAGAGGTTG -3'

Sequencing Primer
(F):5'- TGGCACGACCACAGTAATTTCTG -3'
(R):5'- CAACTACATTTGAGGTCTCTTGAGG -3'
Posted On2015-02-05