Incidental Mutation 'R3032:Park7'
ID264747
Institutional Source Beutler Lab
Gene Symbol Park7
Ensembl Gene ENSMUSG00000028964
Gene NameParkinson disease (autosomal recessive, early onset) 7
SynonymsDJ-1
MMRRC Submission 040548-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R3032 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150897133-150914437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150901052 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 122 (K122R)
Ref Sequence ENSEMBL: ENSMUSP00000101300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]
Predicted Effect probably benign
Transcript: ENSMUST00000030805
AA Change: K122R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: K122R

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105673
AA Change: K122R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: K122R

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105674
AA Change: K122R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: K122R

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 4 171 1.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105675
AA Change: K122R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: K122R

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105676
AA Change: K122R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: K122R

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.7e-16 PFAM
Pfam:DJ-1_PfpI 32 171 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128075
AA Change: K122R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: K122R

DomainStartEndE-ValueType
Pfam:DUF4066 9 135 1.1e-15 PFAM
Pfam:DJ-1_PfpI 32 136 1.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132265
Predicted Effect probably benign
Transcript: ENSMUST00000134751
SMART Domains Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 114 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146184
SMART Domains Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 84 4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148626
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 A T 14: 8,253,466 L227Q probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dpysl4 A G 7: 139,096,236 N315D probably benign Het
Eps8 A T 6: 137,512,177 S408T probably damaging Het
F13b A C 1: 139,517,333 T574P probably damaging Het
Fgfrl1 A G 5: 108,706,060 I344M probably benign Het
Olfr1444 G A 19: 12,861,918 V48I probably benign Het
Psg18 G A 7: 18,350,979 S64L probably benign Het
Rhbdf1 T C 11: 32,209,985 D172G probably damaging Het
Serpinb6b G A 13: 32,968,568 G20D possibly damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Syt14 A T 1: 192,986,751 Y65N possibly damaging Het
Tll1 T C 8: 64,098,492 N285S probably damaging Het
Umodl1 G A 17: 30,989,528 R849Q probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Other mutations in Park7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Park7 APN 4 150903831 missense probably benign 0.28
stiffed UTSW 4 150907090 missense possibly damaging 0.82
R0268:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R0344:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R2062:Park7 UTSW 4 150905275 missense probably benign 0.05
R2416:Park7 UTSW 4 150908401 missense probably benign 0.01
R4638:Park7 UTSW 4 150907099 nonsense probably null
R5345:Park7 UTSW 4 150908423 splice site probably benign
R6585:Park7 UTSW 4 150905264 missense probably benign 0.01
R7957:Park7 UTSW 4 150903884 missense probably damaging 1.00
R8155:Park7 UTSW 4 150907090 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAACTGCTGTCACGGATTCGG -3'
(R):5'- TGACTGTTCAGACTCGGGTG -3'

Sequencing Primer
(F):5'- CTGCTGTCACGGATTCGGTAAAAAC -3'
(R):5'- TCTGGAACTGACTCTGTAGACCAAG -3'
Posted On2015-02-05