Mutagenetix > Incidental Mutation

Incidental Mutation 'R3032:Umodl1'

264760

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

040548-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3032 (G1)

Quality Score

177

Status

Not validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30989528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 849 (R849Q)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: R849Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: R849Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000066981
AA Change: R734Q

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: R734Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: R849Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: R849Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	A	T	14: 8,253,466	L227Q	probably damaging	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dpysl4	A	G	7: 139,096,236	N315D	probably benign	Het
Eps8	A	T	6: 137,512,177	S408T	probably damaging	Het
F13b	A	C	1: 139,517,333	T574P	probably damaging	Het
Fgfrl1	A	G	5: 108,706,060	I344M	probably benign	Het
Olfr1444	G	A	19: 12,861,918	V48I	probably benign	Het
Park7	T	C	4: 150,901,052	K122R	probably benign	Het
Psg18	G	A	7: 18,350,979	S64L	probably benign	Het
Rhbdf1	T	C	11: 32,209,985	D172G	probably damaging	Het
Serpinb6b	G	A	13: 32,968,568	G20D	possibly damaging	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Syt14	A	T	1: 192,986,751	Y65N	possibly damaging	Het
Tll1	T	C	8: 64,098,492	N285S	probably damaging	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAGGACAGCTTTGATGC -3'
(R):5'- CAAGAAGGGGTATGGCTTCTGC -3'

Sequencing Primer
(F):5'- CAGGACAGCTTTGATGCTCCTG -3'
(R):5'- CAGGATGCTTAAACCTGCTGG -3'

Posted On

2015-02-05