Incidental Mutation 'R3034:Pmvk'
ID264774
Institutional Source Beutler Lab
Gene Symbol Pmvk
Ensembl Gene ENSMUSG00000027952
Gene Namephosphomevalonate kinase
Synonyms
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89454541-89469013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89468517 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000143154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029564] [ENSMUST00000107410] [ENSMUST00000184515] [ENSMUST00000198440]
Predicted Effect probably damaging
Transcript: ENSMUST00000029564
AA Change: V149A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029564
Gene: ENSMUSG00000027952
AA Change: V149A

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 124 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107410
SMART Domains Protein: ENSMUSP00000103033
Gene: ENSMUSG00000027952

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 129 9.3e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184515
AA Change: V128A

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139116
Gene: ENSMUSG00000027952
AA Change: V128A

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 5 108 3.9e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198440
AA Change: V74A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143154
Gene: ENSMUSG00000027952
AA Change: V74A

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 1 54 5.6e-19 PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Pmvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Pmvk APN 3 89467583 missense probably damaging 1.00
R2090:Pmvk UTSW 3 89461882 missense possibly damaging 0.53
R5337:Pmvk UTSW 3 89468571 missense probably benign 0.36
R5469:Pmvk UTSW 3 89467682 critical splice donor site probably null
R5842:Pmvk UTSW 3 89467620 missense probably damaging 1.00
R5877:Pmvk UTSW 3 89464369 missense probably benign 0.25
R7657:Pmvk UTSW 3 89468851 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACAGTGTCAAGCCCTTTCGG -3'
(R):5'- ATCTGGCAGAACCACTGTTC -3'

Sequencing Primer
(F):5'- GTCTGCAGTTGTTGATCCAGTC -3'
(R):5'- AACCACTGTTCGCCAGG -3'
Posted On2015-02-05