Incidental Mutation 'R3034:Aptx'
ID264775
Institutional Source Beutler Lab
Gene Symbol Aptx
Ensembl Gene ENSMUSG00000028411
Gene Nameaprataxin
Synonyms
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40682382-40703194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40694994 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 114 (N114S)
Ref Sequence ENSEMBL: ENSMUSP00000124264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030119] [ENSMUST00000068125] [ENSMUST00000108103] [ENSMUST00000129021] [ENSMUST00000155710]
Predicted Effect probably benign
Transcript: ENSMUST00000030119
AA Change: N107S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030119
Gene: ENSMUSG00000028411
AA Change: N107S

DomainStartEndE-ValueType
PDB:3KT9|A 1 101 2e-61 PDB
Blast:FHA 24 68 7e-18 BLAST
Pfam:DcpS_C 160 271 3.1e-36 PFAM
Pfam:HIT 167 262 9.2e-17 PFAM
ZnF_C2H2 310 332 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068125
AA Change: N114S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124264
Gene: ENSMUSG00000028411
AA Change: N114S

DomainStartEndE-ValueType
PDB:3KT9|A 8 108 2e-61 PDB
Blast:FHA 31 75 7e-18 BLAST
Pfam:DcpS_C 167 278 5.9e-37 PFAM
Pfam:HIT 174 269 1.3e-16 PFAM
ZnF_C2H2 317 339 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108103
SMART Domains Protein: ENSMUSP00000103738
Gene: ENSMUSG00000028411

DomainStartEndE-ValueType
Blast:FHA 24 59 4e-13 BLAST
Pfam:DcpS_C 65 176 2.2e-36 PFAM
Pfam:HIT 72 167 8.8e-17 PFAM
ZnF_C2H2 215 237 2.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128810
Predicted Effect probably benign
Transcript: ENSMUST00000129021
Predicted Effect probably benign
Transcript: ENSMUST00000155710
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in single-strand DNA break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Aptx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Aptx APN 4 40688133 missense probably damaging 1.00
IGL02419:Aptx APN 4 40691032 missense probably benign 0.01
IGL03188:Aptx APN 4 40695143 splice site probably null
IGL02991:Aptx UTSW 4 40686687 missense probably damaging 1.00
R0003:Aptx UTSW 4 40695145 splice site probably benign
R1250:Aptx UTSW 4 40693447 missense probably benign 0.00
R1681:Aptx UTSW 4 40697274 missense probably benign 0.13
R2512:Aptx UTSW 4 40694917 missense probably benign 0.00
R4610:Aptx UTSW 4 40702766 utr 5 prime probably null
R6108:Aptx UTSW 4 40694986 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCACAGCATCTTTCAAGC -3'
(R):5'- GCTCTATCACCAATGGCATTAC -3'

Sequencing Primer
(F):5'- GCATCTTTCAAGCACACCATTC -3'
(R):5'- TCATCGGGAAGGACCAA -3'
Posted On2015-02-05