Mutagenetix > Incidental Mutations

Incidental Mutation 'R3034:Aptx'

264775

Institutional Source

Beutler Lab

Gene Symbol

Aptx

Ensembl Gene

ENSMUSG00000028411

Gene Name

aprataxin

Synonyms

MMRRC Submission

040550-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3034 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40682382-40703194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40694994 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 114 (N114S)

Ref Sequence

ENSEMBL: ENSMUSP00000124264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030119] [ENSMUST00000068125] [ENSMUST00000108103] [ENSMUST00000129021] [ENSMUST00000155710]

Predicted Effect

probably benign
Transcript: ENSMUST00000030119
AA Change: N107S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000030119
Gene: ENSMUSG00000028411
AA Change: N107S

Domain	Start	End	E-Value	Type
PDB:3KT9\|A	1	101	2e-61	PDB
Blast:FHA	24	68	7e-18	BLAST
Pfam:DcpS_C	160	271	3.1e-36	PFAM
Pfam:HIT	167	262	9.2e-17	PFAM
ZnF_C2H2	310	332	2.71e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000068125
AA Change: N114S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000124264
Gene: ENSMUSG00000028411
AA Change: N114S

Domain	Start	End	E-Value	Type
PDB:3KT9\|A	8	108	2e-61	PDB
Blast:FHA	31	75	7e-18	BLAST
Pfam:DcpS_C	167	278	5.9e-37	PFAM
Pfam:HIT	174	269	1.3e-16	PFAM
ZnF_C2H2	317	339	2.71e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108103

SMART Domains

Protein: ENSMUSP00000103738
Gene: ENSMUSG00000028411

Domain	Start	End	E-Value	Type
Blast:FHA	24	59	4e-13	BLAST
Pfam:DcpS_C	65	176	2.2e-36	PFAM
Pfam:HIT	72	167	8.8e-17	PFAM
ZnF_C2H2	215	237	2.71e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128810

Predicted Effect

probably benign
Transcript: ENSMUST00000129021

Predicted Effect

probably benign
Transcript: ENSMUST00000155710

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in single-strand DNA break repair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox12e	T	C	11: 70,316,253	I576V	probably benign	Het
Apol7a	T	G	15: 77,389,723	I180L	probably benign	Het
Cd40	T	A	2: 165,062,315	S65R	probably benign	Het
Cdh23	C	T	10: 60,409,010		probably benign	Het
Coro7	G	A	16: 4,632,291	R565W	probably damaging	Het
Cpt1a	C	T	19: 3,378,390	T588M	probably damaging	Het
Defb23	A	G	2: 152,459,269	S128P	possibly damaging	Het
Dgki	G	A	6: 37,087,670	H250Y	probably damaging	Het
Fgr	T	C	4: 132,998,496		probably null	Het
Fkbp15	T	C	4: 62,306,892		probably null	Het
Gpr137c	C	T	14: 45,220,276	S95L	probably damaging	Het
Kirrel	T	C	3: 87,083,439	D692G	possibly damaging	Het
Krt1	C	A	15: 101,850,633	R32L	unknown	Het
Lama2	C	T	10: 27,001,235	E2652K	probably benign	Het
Mbl1	C	A	14: 41,158,833	S226Y	probably damaging	Het
Mrps28	T	A	3: 8,923,615	D61V	probably benign	Het
Mthfd1	A	G	12: 76,289,470	K299E	probably benign	Het
Myo1b	A	G	1: 51,773,247	Y738H	possibly damaging	Het
Myo5c	A	G	9: 75,286,577	T1205A	probably benign	Het
Nfatc2	C	T	2: 168,535,020	G317S	probably damaging	Het
Nln	C	T	13: 104,037,439	V525I	possibly damaging	Het
Nrap	T	C	19: 56,364,005	E549G	probably damaging	Het
Nwd2	T	A	5: 63,800,103	Y259N	probably damaging	Het
Oas3	T	C	5: 120,771,056	D275G	probably damaging	Het
Olfr294	A	T	7: 86,615,762	D294E	possibly damaging	Het
Ovch2	A	G	7: 107,785,492	S473P	probably damaging	Het
Pde8b	T	A	13: 95,222,767	Y16F	probably damaging	Het
Pmfbp1	A	T	8: 109,520,921		probably null	Het
Pmvk	T	C	3: 89,468,517	V74A	probably damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rbm26	T	A	14: 105,153,445	T202S	unknown	Het
Rheb	C	T	5: 24,803,723	E166K	probably damaging	Het
Rnf5	A	G	17: 34,603,358	V39A	possibly damaging	Het
Scn7a	T	C	2: 66,682,808	Y1168C	probably damaging	Het
Tas2r114	A	G	6: 131,689,648	I139T	probably benign	Het
Tma7	T	C	9: 109,082,206		probably benign	Het
Tmem181a	T	A	17: 6,280,626	S13T	possibly damaging	Het
Tmem62	C	T	2: 120,979,124		probably benign	Het
Trim71	T	C	9: 114,512,844	D790G	probably damaging	Het
Trp53tg5	T	C	2: 164,471,299	K152R	probably benign	Het
Uhrf1bp1	T	A	17: 27,894,746	D1297E	probably damaging	Het
Zdbf2	C	A	1: 63,304,205	A581E	probably damaging	Het

Other mutations in Aptx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Aptx	APN	4	40688133	missense	probably damaging	1.00
IGL02419:Aptx	APN	4	40691032	missense	probably benign	0.01
IGL03188:Aptx	APN	4	40695143	splice site	probably null
IGL02991:Aptx	UTSW	4	40686687	missense	probably damaging	1.00
R0003:Aptx	UTSW	4	40695145	splice site	probably benign
R1250:Aptx	UTSW	4	40693447	missense	probably benign	0.00
R1681:Aptx	UTSW	4	40697274	missense	probably benign	0.13
R2512:Aptx	UTSW	4	40694917	missense	probably benign	0.00
R4610:Aptx	UTSW	4	40702766	utr 5 prime	probably null
R6108:Aptx	UTSW	4	40694986	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCACAGCATCTTTCAAGC -3'
(R):5'- GCTCTATCACCAATGGCATTAC -3'

Sequencing Primer
(F):5'- GCATCTTTCAAGCACACCATTC -3'
(R):5'- TCATCGGGAAGGACCAA -3'

Posted On

2015-02-05