Incidental Mutation 'R3034:Oas3'
ID264780
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120771056 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 275 (D275G)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
Predicted Effect probably damaging
Transcript: ENSMUST00000044833
AA Change: D275G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: D275G

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Meta Mutation Damage Score 0.3106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAAACAGGCACGGTGTGAG -3'
(R):5'- CTGAGGAAGCAGTTCACAGC -3'

Sequencing Primer
(F):5'- TGAGCCCTGGGTATGGTTC -3'
(R):5'- GGTTCACAGGTGCAGACAC -3'
Posted On2015-02-05