Incidental Mutation 'R3034:Olfr294'
ID264783
Institutional Source Beutler Lab
Gene Symbol Olfr294
Ensembl Gene ENSMUSG00000062042
Gene Nameolfactory receptor 294
SynonymsGA_x6K02T2NHDJ-9504525-9505532, MOR219-5
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86615636-86616643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86615762 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 294 (D294E)
Ref Sequence ENSEMBL: ENSMUSP00000077662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078588]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078588
AA Change: D294E

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: D294E

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-38 PFAM
Pfam:7tm_1 39 288 1.8e-22 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Olfr294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Olfr294 APN 7 86615997 missense probably damaging 1.00
IGL02617:Olfr294 APN 7 86615664 missense probably benign 0.14
IGL02694:Olfr294 APN 7 86616310 missense probably benign 0.00
IGL02828:Olfr294 APN 7 86616069 missense possibly damaging 0.67
IGL03229:Olfr294 APN 7 86616078 missense probably benign 0.00
IGL03351:Olfr294 APN 7 86615677 missense possibly damaging 0.68
PIT4802001:Olfr294 UTSW 7 86616555 missense probably null 1.00
R0848:Olfr294 UTSW 7 86615640 missense probably damaging 0.96
R1448:Olfr294 UTSW 7 86616361 missense probably damaging 1.00
R1720:Olfr294 UTSW 7 86616456 missense probably damaging 1.00
R1734:Olfr294 UTSW 7 86616217 missense probably benign 0.07
R1959:Olfr294 UTSW 7 86616431 missense probably benign 0.00
R2116:Olfr294 UTSW 7 86616078 missense probably benign 0.00
R2518:Olfr294 UTSW 7 86616187 missense probably benign 0.03
R3110:Olfr294 UTSW 7 86615676 missense probably benign
R3112:Olfr294 UTSW 7 86615676 missense probably benign
R3690:Olfr294 UTSW 7 86616478 missense probably damaging 1.00
R4612:Olfr294 UTSW 7 86615736 missense probably benign 0.00
R6476:Olfr294 UTSW 7 86616010 missense probably benign 0.04
R6895:Olfr294 UTSW 7 86616115 missense probably damaging 1.00
R7102:Olfr294 UTSW 7 86616267 missense probably benign 0.25
R7104:Olfr294 UTSW 7 86615692 missense probably null 0.07
R7179:Olfr294 UTSW 7 86616366 missense possibly damaging 0.76
R7256:Olfr294 UTSW 7 86615665 missense probably benign 0.03
R7624:Olfr294 UTSW 7 86616561 missense possibly damaging 0.47
R8422:Olfr294 UTSW 7 86616258 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCAGATCAGCTATCACCTGAGTG -3'
(R):5'- ATTCCTACCACTAAAGGTCAGTAC -3'

Sequencing Primer
(F):5'- CACCTGAGTGTTTTTATTTCTCAAGG -3'
(R):5'- GGTCAGTACAAAGCATTTGGC -3'
Posted On2015-02-05