Incidental Mutation 'I1329:Prpf40a'
ID26480
Institutional Source Beutler Lab
Gene Symbol Prpf40a
Ensembl Gene ENSMUSG00000061136
Gene Namepre-mRNA processing factor 40A
SynonymsFnbp3, FBP11, 2810012K09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location53134704-53191284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53176395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 92 (V92L)
Ref Sequence ENSEMBL: ENSMUSP00000147599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076313] [ENSMUST00000125243] [ENSMUST00000209364] [ENSMUST00000209508] [ENSMUST00000210789] [ENSMUST00000211102] [ENSMUST00000211712]
Predicted Effect probably benign
Transcript: ENSMUST00000076313
AA Change: V134L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136
AA Change: V134L

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125243
SMART Domains Protein: ENSMUSP00000117406
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 35 82 N/A INTRINSIC
WW 99 131 7.54e-13 SMART
WW 140 172 1.57e-10 SMART
low complexity region 230 252 N/A INTRINSIC
FF 347 401 1.32e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152922
Predicted Effect probably benign
Transcript: ENSMUST00000209364
AA Change: V107L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000209508
Predicted Effect probably benign
Transcript: ENSMUST00000210789
AA Change: V92L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000211102
AA Change: V79L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Prpf40a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Prpf40a APN 2 53150688 missense probably benign 0.00
IGL00533:Prpf40a APN 2 53145343 missense probably damaging 1.00
IGL01099:Prpf40a APN 2 53141835 missense probably benign 0.00
IGL02039:Prpf40a APN 2 53144803 missense probably damaging 1.00
IGL02608:Prpf40a APN 2 53146153 missense probably damaging 0.97
R0284:Prpf40a UTSW 2 53150647 missense probably damaging 1.00
R0401:Prpf40a UTSW 2 53159313 missense probably damaging 0.99
R0544:Prpf40a UTSW 2 53141651 unclassified probably benign
R0582:Prpf40a UTSW 2 53145692 missense probably damaging 1.00
R1533:Prpf40a UTSW 2 53145840 missense probably damaging 1.00
R2057:Prpf40a UTSW 2 53144839 missense probably damaging 1.00
R4274:Prpf40a UTSW 2 53146172 missense probably damaging 1.00
R4604:Prpf40a UTSW 2 53142023 missense probably damaging 0.99
R4814:Prpf40a UTSW 2 53190020 missense probably damaging 1.00
R4976:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5119:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5378:Prpf40a UTSW 2 53145876 missense probably damaging 1.00
R5448:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5449:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5450:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5500:Prpf40a UTSW 2 53145284 missense probably benign 0.03
R5637:Prpf40a UTSW 2 53156734 missense possibly damaging 0.59
R6052:Prpf40a UTSW 2 53159281 missense probably benign 0.41
R6149:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6150:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6151:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6162:Prpf40a UTSW 2 53159305 missense probably benign 0.01
R6199:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6200:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6207:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6254:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6266:Prpf40a UTSW 2 53156627 missense probably benign 0.17
R6394:Prpf40a UTSW 2 53144878 missense probably damaging 1.00
R6603:Prpf40a UTSW 2 53152963 missense probably damaging 0.96
R6606:Prpf40a UTSW 2 53151751 missense probably damaging 0.99
R6641:Prpf40a UTSW 2 53141626 unclassified probably benign
R6929:Prpf40a UTSW 2 53144863 missense possibly damaging 0.95
R7158:Prpf40a UTSW 2 53152553 missense probably damaging 0.99
R7401:Prpf40a UTSW 2 53156947 missense probably benign 0.01
R7675:Prpf40a UTSW 2 53145636 missense possibly damaging 0.89
R7750:Prpf40a UTSW 2 53151745 missense probably damaging 1.00
R7893:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R7976:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R8027:Prpf40a UTSW 2 53191138 missense probably benign 0.01
X0060:Prpf40a UTSW 2 53145664 missense probably damaging 0.96
Z1176:Prpf40a UTSW 2 53144875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCACACAATGTCTAACTTTAGCAACC -3'
(R):5'- AGCGACTCCAGTGTTGATGAGC -3'

Sequencing Primer
(F):5'- tgcccaaggacagaagaag -3'
(R):5'- GCTCTTGAAATACATAGCAAGCC -3'
Posted On2013-04-16