Incidental Mutation 'R3035:Rab36'
ID264823
Institutional Source Beutler Lab
Gene Symbol Rab36
Ensembl Gene ENSMUSG00000020175
Gene NameRAB36, member RAS oncogene family
Synonyms
MMRRC Submission 040551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3035 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75037058-75054748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75044496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000119399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020391] [ENSMUST00000139384] [ENSMUST00000146440] [ENSMUST00000147802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020391
AA Change: V63I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020391
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136944
Predicted Effect probably damaging
Transcript: ENSMUST00000139384
AA Change: V63I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118718
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Arf 42 134 6.3e-8 PFAM
Pfam:Ras 74 134 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142507
Predicted Effect probably damaging
Transcript: ENSMUST00000146440
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121693
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147802
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119399
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151432
Meta Mutation Damage Score 0.2092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,745,418 V687D probably benign Het
Ahctf1 T A 1: 179,753,870 Q1589L probably damaging Het
Apba2 T C 7: 64,739,792 S479P probably benign Het
C1galt1 A G 6: 7,866,762 K203E probably benign Het
Dennd5a A G 7: 109,921,352 S433P probably benign Het
Dock9 A G 14: 121,606,837 S1181P possibly damaging Het
Gsc2 A G 16: 17,914,928 S26P probably damaging Het
Hcn4 T C 9: 58,823,680 S57P unknown Het
Herc1 C A 9: 66,483,935 Q4007K possibly damaging Het
Ighv1-54 C A 12: 115,193,977 V17F probably damaging Het
Kctd12 T A 14: 102,981,506 E312V possibly damaging Het
Kdf1 A G 4: 133,528,062 N30S probably benign Het
Kif11 T A 19: 37,407,053 S587T possibly damaging Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mgam A G 6: 40,663,530 I511V probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Serpinb9b T A 13: 33,029,546 C29S possibly damaging Het
Slc12a5 C A 2: 164,980,258 L343I probably benign Het
Topors C T 4: 40,269,673 probably null Het
Other mutations in Rab36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Rab36 APN 10 75048466 missense probably damaging 1.00
IGL01554:Rab36 APN 10 75050688 missense possibly damaging 0.50
IGL02197:Rab36 APN 10 75052042 missense probably damaging 0.96
R2022:Rab36 UTSW 10 75052474 missense probably benign 0.13
R2907:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R2991:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3012:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3033:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3034:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3036:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3440:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3686:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3687:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3688:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4398:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4426:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4427:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4433:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4456:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4457:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4467:Rab36 UTSW 10 75052043 nonsense probably null
R4689:Rab36 UTSW 10 75041933 critical splice donor site probably null
R5043:Rab36 UTSW 10 75051005 missense probably benign 0.00
R5568:Rab36 UTSW 10 75052479 missense probably benign
R8354:Rab36 UTSW 10 75048459 missense probably damaging 1.00
R8523:Rab36 UTSW 10 75052503 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGACATTGGCCAAAGGGG -3'
(R):5'- GGCCTTTACCACACCCTTCA -3'

Sequencing Primer
(F):5'- GGAGTGTATGTTCTCCCATATCCCAG -3'
(R):5'- AAACTGTTTCCCAGGCTCAGG -3'
Posted On2015-02-05