Incidental Mutation 'R3037:Pced1a'
ID 264834
Institutional Source Beutler Lab
Gene Symbol Pced1a
Ensembl Gene ENSMUSG00000037773
Gene Name PC-esterase domain containing 1A
Synonyms Fam113a, A930025D01Rik
MMRRC Submission 040553-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3037 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 130417247-130424701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 130419859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 291 (D291E)
Ref Sequence ENSEMBL: ENSMUSP00000105906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]
AlphaFold Q6P1Z5
Predicted Effect probably benign
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089581
AA Change: D291E

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773
AA Change: D291E

DomainStartEndE-ValueType
Pfam:PC-Esterase 18 267 4e-52 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110277
AA Change: D291E

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773
AA Change: D291E

DomainStartEndE-ValueType
Pfam:PC-Esterase 21 268 3.8e-51 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153663
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,445,978 probably null Het
Bco1 A G 8: 117,127,539 Y401C probably benign Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Ets2 C A 16: 95,716,065 N280K probably benign Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Pdlim4 C A 11: 54,056,257 G72V probably benign Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Topors C T 4: 40,269,673 probably null Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Ttyh3 C A 5: 140,648,842 probably benign Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Pced1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pced1a APN 2 130419178 missense probably benign 0.00
IGL02173:Pced1a APN 2 130422328 missense possibly damaging 0.46
IGL02547:Pced1a APN 2 130419707 missense possibly damaging 0.74
IGL02729:Pced1a APN 2 130421903 missense probably benign 0.01
IGL03107:Pced1a APN 2 130422835 missense possibly damaging 0.81
R0139:Pced1a UTSW 2 130421907 missense probably benign 0.00
R0550:Pced1a UTSW 2 130419633 missense probably benign 0.00
R0578:Pced1a UTSW 2 130419843 missense probably damaging 0.98
R3157:Pced1a UTSW 2 130419767 missense probably benign 0.12
R4578:Pced1a UTSW 2 130422676 missense probably damaging 1.00
R5306:Pced1a UTSW 2 130419171 missense probably benign
R6210:Pced1a UTSW 2 130421919 missense probably damaging 1.00
R7444:Pced1a UTSW 2 130422059 missense probably damaging 0.98
R7459:Pced1a UTSW 2 130419824 missense possibly damaging 0.59
R7524:Pced1a UTSW 2 130422028 missense probably benign 0.44
R7744:Pced1a UTSW 2 130422052 missense probably damaging 1.00
R7782:Pced1a UTSW 2 130422515 missense probably damaging 0.99
R7851:Pced1a UTSW 2 130422316 missense probably damaging 0.99
R8300:Pced1a UTSW 2 130424237 unclassified probably benign
R8404:Pced1a UTSW 2 130423657 unclassified probably benign
R8502:Pced1a UTSW 2 130423657 unclassified probably benign
R8990:Pced1a UTSW 2 130422551 missense probably damaging 1.00
Z1177:Pced1a UTSW 2 130422628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGCATTGAGAAGTCCTC -3'
(R):5'- TCTTGGCTTGAAGTGAAAGGAG -3'

Sequencing Primer
(F):5'- GGCATTGAGAAGTCCTCCATTGC -3'
(R):5'- GACGAGGAAGGCTACTGTTCTC -3'
Posted On 2015-02-05