Incidental Mutation 'R3037:Ttyh3'
ID264844
Institutional Source Beutler Lab
Gene Symbol Ttyh3
Ensembl Gene ENSMUSG00000036565
Gene Nametweety family member 3
Synonyms
MMRRC Submission 040553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3037 (G1)
Quality Score80.1
Status Not validated
Chromosome5
Chromosomal Location140620578-140649031 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 140648842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042661] [ENSMUST00000197452]
Predicted Effect probably benign
Transcript: ENSMUST00000042661
SMART Domains Protein: ENSMUSP00000037447
Gene: ENSMUSG00000036565

DomainStartEndE-ValueType
Pfam:Tweety 25 430 9.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197452
SMART Domains Protein: ENSMUSP00000142655
Gene: ENSMUSG00000036565

DomainStartEndE-ValueType
Pfam:Tweety 25 430 1.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200302
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,445,978 probably null Het
Bco1 A G 8: 117,127,539 Y401C probably benign Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Ets2 C A 16: 95,716,065 N280K probably benign Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pced1a A C 2: 130,419,859 D291E probably benign Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Pdlim4 C A 11: 54,056,257 G72V probably benign Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Topors C T 4: 40,269,673 probably null Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Ttyh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ttyh3 APN 5 140629412 missense probably damaging 0.99
IGL01324:Ttyh3 APN 5 140631513 missense probably benign 0.00
IGL01982:Ttyh3 APN 5 140636074 splice site probably benign
IGL02002:Ttyh3 APN 5 140629483 missense probably damaging 1.00
IGL02218:Ttyh3 APN 5 140626491 missense probably damaging 1.00
IGL02385:Ttyh3 APN 5 140633305 missense probably benign 0.03
IGL02510:Ttyh3 APN 5 140629464 missense probably damaging 1.00
R0843:Ttyh3 UTSW 5 140626446 splice site probably null
R3774:Ttyh3 UTSW 5 140648734 missense probably damaging 0.99
R4795:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4796:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4868:Ttyh3 UTSW 5 140629466 missense probably damaging 1.00
R5671:Ttyh3 UTSW 5 140631552 missense probably benign 0.02
R6107:Ttyh3 UTSW 5 140633562 critical splice donor site probably null
R6363:Ttyh3 UTSW 5 140635224 missense probably damaging 1.00
R7104:Ttyh3 UTSW 5 140629785 missense probably benign 0.00
R7454:Ttyh3 UTSW 5 140629425 missense possibly damaging 0.95
R7798:Ttyh3 UTSW 5 140634783 missense probably damaging 1.00
R7810:Ttyh3 UTSW 5 140625141 missense
Predicted Primers PCR Primer
(F):5'- TTATCAGTGAACGGGAGGCG -3'
(R):5'- CCAATAGCATTGTGTGGGGC -3'

Sequencing Primer
(F):5'- TTGGGAGGGGCCATGAC -3'
(R):5'- CAGCGGCGGTGAACAAAG -3'
Posted On2015-02-05