Incidental Mutation 'R3037:Cntnap2'
ID 264846
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 040553-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3037 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45992200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 376 (V376I)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000114641
AA Change: V376I

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: V376I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,582,486 (GRCm39) probably null Het
Bco1 A G 8: 117,854,278 (GRCm39) Y401C probably benign Het
Bod1l A T 5: 41,979,380 (GRCm39) S645T probably damaging Het
Cat A G 2: 103,298,122 (GRCm39) Y274H probably benign Het
Cdh19 C A 1: 110,882,337 (GRCm39) V52F probably damaging Het
Dll3 A G 7: 27,998,542 (GRCm39) L141P probably damaging Het
Ets2 C A 16: 95,517,109 (GRCm39) N280K probably benign Het
Fam186a G T 15: 99,841,675 (GRCm39) P1523Q probably damaging Het
Fcgbp A G 7: 27,802,127 (GRCm39) I1352V possibly damaging Het
Fcsk A T 8: 111,621,350 (GRCm39) probably null Het
Gng11 A G 6: 4,008,051 (GRCm39) E38G probably benign Het
Gsdmc2 A T 15: 63,705,180 (GRCm39) F178I probably benign Het
Il11ra1 T A 4: 41,765,074 (GRCm39) S133R possibly damaging Het
Kcnab2 T A 4: 152,478,213 (GRCm39) I349F possibly damaging Het
Kctd10 A G 5: 114,513,061 (GRCm39) V38A probably damaging Het
Lrig3 A G 10: 125,845,901 (GRCm39) R777G probably damaging Het
Naip2 A C 13: 100,291,457 (GRCm39) D1160E probably benign Het
Nanog C A 6: 122,690,227 (GRCm39) Q186K possibly damaging Het
Nlrc3 T C 16: 3,770,272 (GRCm39) N249S probably damaging Het
Nup214 A T 2: 31,866,632 (GRCm39) T56S probably benign Het
Or8k41 A T 2: 86,313,987 (GRCm39) I33N probably damaging Het
Pcdhb1 T G 18: 37,398,166 (GRCm39) M39R probably damaging Het
Pced1a A C 2: 130,261,779 (GRCm39) D291E probably benign Het
Pdia6 C T 12: 17,329,646 (GRCm39) R261W probably damaging Het
Pdlim4 C A 11: 53,947,083 (GRCm39) G72V probably benign Het
Plce1 G A 19: 38,766,328 (GRCm39) D2104N probably damaging Het
Ptprk T C 10: 28,456,474 (GRCm39) L7P probably damaging Het
Rad21l A T 2: 151,502,700 (GRCm39) F170Y probably damaging Het
Scaf1 T C 7: 44,656,771 (GRCm39) probably benign Het
Topors C T 4: 40,269,673 (GRCm39) probably null Het
Trpm5 G A 7: 142,639,200 (GRCm39) T239I probably benign Het
Tspan5 G A 3: 138,604,116 (GRCm39) G167D probably damaging Het
Ttyh3 C A 5: 140,634,597 (GRCm39) probably benign Het
Usp15 C A 10: 122,999,522 (GRCm39) W220L probably damaging Het
Vmn2r77 A T 7: 86,450,191 (GRCm39) I146L probably benign Het
Ythdf3 T C 3: 16,259,355 (GRCm39) F501L probably benign Het
Zc3h4 A G 7: 16,155,410 (GRCm39) D241G unknown Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTAACACTCCAGAAAGTTCCAGG -3'
(R):5'- TGACACTGACCTGAGGAGATG -3'

Sequencing Primer
(F):5'- TCCAGGAGGATTCATGCATGC -3'
(R):5'- CACTGACCTGAGGAGATGTCAATTTG -3'
Posted On 2015-02-05