Incidental Mutation 'R3037:Bco1'
ID264855
Institutional Source Beutler Lab
Gene Symbol Bco1
Ensembl Gene ENSMUSG00000031845
Gene Namebeta-carotene oxygenase 1
SynonymsBcdo1, betaCMOOX, Bcmo1, Bcdo, beta-CD, Cmoi
MMRRC Submission 040553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3037 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117095854-117133720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117127539 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 401 (Y401C)
Ref Sequence ENSEMBL: ENSMUSP00000134815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034308] [ENSMUST00000167370] [ENSMUST00000176860]
Predicted Effect probably benign
Transcript: ENSMUST00000034308
AA Change: Y401C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034308
Gene: ENSMUSG00000031845
AA Change: Y401C

DomainStartEndE-ValueType
Pfam:RPE65 5 519 9e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167370
AA Change: Y401C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132042
Gene: ENSMUSG00000031845
AA Change: Y401C

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176860
AA Change: Y401C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134815
Gene: ENSMUSG00000031845
AA Change: Y401C

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176943
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Vitamin A metabolism is important for vital processes such as vision, embryonic development, cell differentiation, and membrane and skin protection. The protein encoded by this gene is a key enzyme in beta-carotene metabolism to vitamin A. It catalyzes the oxidative cleavage of beta,beta-carotene into two retinal molecules. Two alternatively spliced variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null mutation display fatty livers, elevated serum free fatty acid levels, increased susceptibility to diet-induced obesity, and impaired conversion of beta-carotene to vitamin A. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,445,978 probably null Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Ets2 C A 16: 95,716,065 N280K probably benign Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pced1a A C 2: 130,419,859 D291E probably benign Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Pdlim4 C A 11: 54,056,257 G72V probably benign Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Topors C T 4: 40,269,673 probably null Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Ttyh3 C A 5: 140,648,842 probably benign Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Bco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Bco1 APN 8 117130637 missense probably damaging 1.00
IGL01934:Bco1 APN 8 117096045 missense possibly damaging 0.90
IGL02182:Bco1 APN 8 117133066 missense probably damaging 1.00
IGL02375:Bco1 APN 8 117113439 missense probably benign 0.13
IGL02705:Bco1 APN 8 117117503 missense possibly damaging 0.95
H8562:Bco1 UTSW 8 117105647 splice site probably benign
R0453:Bco1 UTSW 8 117108777 missense possibly damaging 0.55
R0652:Bco1 UTSW 8 117105696 missense probably damaging 1.00
R1619:Bco1 UTSW 8 117108715 missense probably damaging 1.00
R1772:Bco1 UTSW 8 117130608 missense probably benign 0.03
R1827:Bco1 UTSW 8 117105759 missense probably damaging 1.00
R1834:Bco1 UTSW 8 117117437 missense probably benign 0.01
R2261:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2262:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2273:Bco1 UTSW 8 117108783 critical splice donor site probably null
R2274:Bco1 UTSW 8 117108783 critical splice donor site probably null
R3792:Bco1 UTSW 8 117130676 missense possibly damaging 0.95
R3926:Bco1 UTSW 8 117127472 missense probably benign
R4193:Bco1 UTSW 8 117113469 missense probably damaging 1.00
R4661:Bco1 UTSW 8 117129241 missense probably benign 0.00
R4968:Bco1 UTSW 8 117131094 missense probably benign 0.00
R5277:Bco1 UTSW 8 117117389 splice site probably null
R5523:Bco1 UTSW 8 117108693 missense possibly damaging 0.67
R6006:Bco1 UTSW 8 117113591 splice site probably null
R6174:Bco1 UTSW 8 117113534 missense probably damaging 0.97
R6458:Bco1 UTSW 8 117127506 missense possibly damaging 0.50
R6815:Bco1 UTSW 8 117113522 missense probably benign 0.00
R7731:Bco1 UTSW 8 117131068 missense possibly damaging 0.73
R7779:Bco1 UTSW 8 117117396 missense probably damaging 0.99
R8087:Bco1 UTSW 8 117108762 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTGCTTCCTGTGGTTACC -3'
(R):5'- CTGTCATCTATCCAAGGACCAG -3'

Sequencing Primer
(F):5'- CTTCCTGTGGTTACCGCGAG -3'
(R):5'- TCTATCCAAGGACCAGAAATGTTGG -3'
Posted On2015-02-05