Mutagenetix > Incidental Mutations

Incidental Mutation 'R3037:Pdlim4'

264860

Institutional Source

Beutler Lab

Gene Symbol

Pdlim4

Ensembl Gene

ENSMUSG00000020388

Gene Name

PDZ and LIM domain 4

Synonyms

Ril

MMRRC Submission

040553-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.250) question?

Stock #

R3037 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54054928-54069014 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 54056257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 72 (G72V)

Ref Sequence

ENSEMBL: ENSMUSP00000121248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018755] [ENSMUST00000093109] [ENSMUST00000144477]

AlphaFold

P70271

Predicted Effect

probably benign
Transcript: ENSMUST00000018755
AA Change: G131V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018755
Gene: ENSMUSG00000020388
AA Change: G131V

Domain	Start	End	E-Value	Type
PDZ	11	84	1.05e-17	SMART
Pfam:DUF4749	142	230	7.2e-14	PFAM
LIM	254	305	9.75e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093109
AA Change: G131V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000090797
Gene: ENSMUSG00000020388
AA Change: G131V

Domain	Start	End	E-Value	Type
PDZ	11	84	1.05e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127271

Predicted Effect

probably benign
Transcript: ENSMUST00000144477
AA Change: G72V

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000121248
Gene: ENSMUSG00000020388
AA Change: G72V

Domain	Start	End	E-Value	Type
Blast:PDZ	1	25	2e-10	BLAST
SCOP:d1qava_	1	25	3e-4	SMART
PDB:2V1W\|B	1	28	2e-11	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which may be involved in bone development. Mutations in this gene are associated with susceptibility to osteoporosis. [provided by RefSeq, Nov 2009]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3b1	T	C	13: 94,445,978		probably null	Het
Bco1	A	G	8: 117,127,539	Y401C	probably benign	Het
Bod1l	A	T	5: 41,822,037	S645T	probably damaging	Het
Cat	A	G	2: 103,467,777	Y274H	probably benign	Het
Cdh19	C	A	1: 110,954,607	V52F	probably damaging	Het
Cntnap2	G	A	6: 46,015,266	V376I	possibly damaging	Het
Dll3	A	G	7: 28,299,117	L141P	probably damaging	Het
Ets2	C	A	16: 95,716,065	N280K	probably benign	Het
Fam186a	G	T	15: 99,943,794	P1523Q	probably damaging	Het
Fcgbp	A	G	7: 28,102,702	I1352V	possibly damaging	Het
Fuk	A	T	8: 110,894,718		probably null	Het
Gng11	A	G	6: 4,008,051	E38G	probably benign	Het
Gsdmc2	A	T	15: 63,833,331	F178I	probably benign	Het
Il11ra1	T	A	4: 41,765,074	S133R	possibly damaging	Het
Kcnab2	T	A	4: 152,393,756	I349F	possibly damaging	Het
Kctd10	A	G	5: 114,375,000	V38A	probably damaging	Het
Lrig3	A	G	10: 126,010,032	R777G	probably damaging	Het
Naip2	A	C	13: 100,154,949	D1160E	probably benign	Het
Nanog	C	A	6: 122,713,268	Q186K	possibly damaging	Het
Nlrc3	T	C	16: 3,952,408	N249S	probably damaging	Het
Nup214	A	T	2: 31,976,620	T56S	probably benign	Het
Olfr228	A	T	2: 86,483,643	I33N	probably damaging	Het
Pcdhb1	T	G	18: 37,265,113	M39R	probably damaging	Het
Pced1a	A	C	2: 130,419,859	D291E	probably benign	Het
Pdia6	C	T	12: 17,279,645	R261W	probably damaging	Het
Plce1	G	A	19: 38,777,884	D2104N	probably damaging	Het
Ptprk	T	C	10: 28,580,478	L7P	probably damaging	Het
Rad21l	A	T	2: 151,660,780	F170Y	probably damaging	Het
Scaf1	T	C	7: 45,007,347		probably benign	Het
Topors	C	T	4: 40,269,673		probably null	Het
Trpm5	G	A	7: 143,085,463	T239I	probably benign	Het
Tspan5	G	A	3: 138,898,355	G167D	probably damaging	Het
Ttyh3	C	A	5: 140,648,842		probably benign	Het
Usp15	C	A	10: 123,163,617	W220L	probably damaging	Het
Vmn2r77	A	T	7: 86,800,983	I146L	probably benign	Het
Ythdf3	T	C	3: 16,205,191	F501L	probably benign	Het
Zc3h4	A	G	7: 16,421,485	D241G	unknown	Het

Other mutations in Pdlim4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Pdlim4	APN	11	54056304	missense	probably benign	0.43
IGL02005:Pdlim4	APN	11	54059984	missense	probably benign	0.10
IGL02305:Pdlim4	APN	11	54055933	missense	probably damaging	1.00
IGL03073:Pdlim4	APN	11	54063641	missense	probably damaging	1.00
BB001:Pdlim4	UTSW	11	54055222	nonsense	probably null
BB011:Pdlim4	UTSW	11	54055222	nonsense	probably null
R0008:Pdlim4	UTSW	11	54055049	missense	probably damaging	1.00
R0612:Pdlim4	UTSW	11	54068887	missense	probably damaging	1.00
R1646:Pdlim4	UTSW	11	54056254	missense	possibly damaging	0.94
R1754:Pdlim4	UTSW	11	54055873	missense	possibly damaging	0.82
R2132:Pdlim4	UTSW	11	54063737	missense	possibly damaging	0.70
R4210:Pdlim4	UTSW	11	54055918	missense	possibly damaging	0.70
R5787:Pdlim4	UTSW	11	54055216	missense	probably damaging	1.00
R5969:Pdlim4	UTSW	11	54063656	missense	possibly damaging	0.50
R6862:Pdlim4	UTSW	11	54055848	missense	probably damaging	1.00
R7924:Pdlim4	UTSW	11	54055222	nonsense	probably null
R8927:Pdlim4	UTSW	11	54059964	missense	probably benign	0.01
R8928:Pdlim4	UTSW	11	54059964	missense	probably benign	0.01
R9026:Pdlim4	UTSW	11	54055454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTAGATCAAACGACAAGGGCC -3'
(R):5'- CAACCATGGACCCTTTTGC -3'

Sequencing Primer
(F):5'- CCAGGAAGGAACTGTAGAGATTTG -3'
(R):5'- ACCCTTTTGCCGGCTGG -3'

Posted On

2015-02-05