Incidental Mutation 'R3037:Pdlim4'
ID 264860
Institutional Source Beutler Lab
Gene Symbol Pdlim4
Ensembl Gene ENSMUSG00000020388
Gene Name PDZ and LIM domain 4
Synonyms Ril
MMRRC Submission 040553-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R3037 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 54054928-54069014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 54056257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 72 (G72V)
Ref Sequence ENSEMBL: ENSMUSP00000121248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018755] [ENSMUST00000093109] [ENSMUST00000144477]
AlphaFold P70271
Predicted Effect probably benign
Transcript: ENSMUST00000018755
AA Change: G131V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018755
Gene: ENSMUSG00000020388
AA Change: G131V

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Pfam:DUF4749 142 230 7.2e-14 PFAM
LIM 254 305 9.75e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093109
AA Change: G131V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090797
Gene: ENSMUSG00000020388
AA Change: G131V

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127271
Predicted Effect probably benign
Transcript: ENSMUST00000144477
AA Change: G72V

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121248
Gene: ENSMUSG00000020388
AA Change: G72V

DomainStartEndE-ValueType
Blast:PDZ 1 25 2e-10 BLAST
SCOP:d1qava_ 1 25 3e-4 SMART
PDB:2V1W|B 1 28 2e-11 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which may be involved in bone development. Mutations in this gene are associated with susceptibility to osteoporosis. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,445,978 probably null Het
Bco1 A G 8: 117,127,539 Y401C probably benign Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Ets2 C A 16: 95,716,065 N280K probably benign Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pced1a A C 2: 130,419,859 D291E probably benign Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Topors C T 4: 40,269,673 probably null Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Ttyh3 C A 5: 140,648,842 probably benign Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Pdlim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Pdlim4 APN 11 54056304 missense probably benign 0.43
IGL02005:Pdlim4 APN 11 54059984 missense probably benign 0.10
IGL02305:Pdlim4 APN 11 54055933 missense probably damaging 1.00
IGL03073:Pdlim4 APN 11 54063641 missense probably damaging 1.00
BB001:Pdlim4 UTSW 11 54055222 nonsense probably null
BB011:Pdlim4 UTSW 11 54055222 nonsense probably null
R0008:Pdlim4 UTSW 11 54055049 missense probably damaging 1.00
R0612:Pdlim4 UTSW 11 54068887 missense probably damaging 1.00
R1646:Pdlim4 UTSW 11 54056254 missense possibly damaging 0.94
R1754:Pdlim4 UTSW 11 54055873 missense possibly damaging 0.82
R2132:Pdlim4 UTSW 11 54063737 missense possibly damaging 0.70
R4210:Pdlim4 UTSW 11 54055918 missense possibly damaging 0.70
R5787:Pdlim4 UTSW 11 54055216 missense probably damaging 1.00
R5969:Pdlim4 UTSW 11 54063656 missense possibly damaging 0.50
R6862:Pdlim4 UTSW 11 54055848 missense probably damaging 1.00
R7924:Pdlim4 UTSW 11 54055222 nonsense probably null
R8927:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R8928:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R9026:Pdlim4 UTSW 11 54055454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGATCAAACGACAAGGGCC -3'
(R):5'- CAACCATGGACCCTTTTGC -3'

Sequencing Primer
(F):5'- CCAGGAAGGAACTGTAGAGATTTG -3'
(R):5'- ACCCTTTTGCCGGCTGG -3'
Posted On 2015-02-05