Incidental Mutation 'R3037:Ap3b1'
ID264862
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Nameadaptor-related protein complex 3, beta 1 subunit
Synonymsrecombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission 040553-MU
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Is this an essential gene? Possibly essential (E-score: 0.618) question?
Stock #R3037 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location94358960-94566317 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94445978 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
Predicted Effect probably null
Transcript: ENSMUST00000022196
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bco1 A G 8: 117,127,539 Y401C probably benign Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Ets2 C A 16: 95,716,065 N280K probably benign Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pced1a A C 2: 130,419,859 D291E probably benign Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Pdlim4 C A 11: 54,056,257 G72V probably benign Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Topors C T 4: 40,269,673 probably null Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Ttyh3 C A 5: 140,648,842 probably benign Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451087 critical splice donor site probably benign
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAAGAGGACACACATAGCTCTC -3'
(R):5'- ACCATGGAACCTGTATGAAGCATAC -3'

Sequencing Primer
(F):5'- GCTCTCATTTACTAAAGCCTTTGAG -3'
(R):5'- TGAAGCATACAGACCTTCAGTG -3'
Posted On2015-02-05