Incidental Mutation 'R3038:Bspry'
ID264876
Institutional Source Beutler Lab
Gene Symbol Bspry
Ensembl Gene ENSMUSG00000028392
Gene NameB-box and SPRY domain containing
Synonymszetin 1
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location62480053-62497298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62496983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 468 (I468V)
Ref Sequence ENSEMBL: ENSMUSP00000030088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030088] [ENSMUST00000037820] [ENSMUST00000107449]
Predicted Effect probably benign
Transcript: ENSMUST00000030088
AA Change: I468V

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030088
Gene: ENSMUSG00000028392
AA Change: I468V

DomainStartEndE-ValueType
low complexity region 9 60 N/A INTRINSIC
Pfam:zf-B_box 65 107 1.2e-8 PFAM
low complexity region 225 239 N/A INTRINSIC
PRY 277 330 1.79e-15 SMART
Pfam:SPRY 333 451 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037820
SMART Domains Protein: ENSMUSP00000036337
Gene: ENSMUSG00000038422

DomainStartEndE-ValueType
Pfam:Hydrolase 7 205 1.3e-15 PFAM
Pfam:HAD_2 10 211 8.9e-20 PFAM
Pfam:Hydrolase_like 164 237 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107449
SMART Domains Protein: ENSMUSP00000103073
Gene: ENSMUSG00000028392

DomainStartEndE-ValueType
low complexity region 9 60 N/A INTRINSIC
Pfam:zf-B_box 65 107 4.4e-9 PFAM
low complexity region 225 239 N/A INTRINSIC
PRY 277 330 1.79e-15 SMART
Pfam:SPRY 331 452 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140038
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Ces1f T A 8: 93,256,598 N506I probably damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mrgpra1 G A 7: 47,334,996 Q312* probably null Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tmed9 A G 13: 55,596,979 K207E probably damaging Het
Tnfrsf19 A G 14: 60,972,063 S253P probably benign Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vmn2r16 G A 5: 109,339,333 C140Y probably damaging Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Bspry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Bspry APN 4 62496105 missense probably benign 0.44
IGL02186:Bspry APN 4 62495989 splice site probably benign
IGL02501:Bspry APN 4 62496435 missense probably benign 0.04
IGL02644:Bspry APN 4 62496328 missense probably damaging 1.00
R0041:Bspry UTSW 4 62486554 missense probably damaging 1.00
R0306:Bspry UTSW 4 62496157 missense probably damaging 1.00
R0560:Bspry UTSW 4 62486449 missense probably damaging 1.00
R1919:Bspry UTSW 4 62494797 missense probably damaging 1.00
R4431:Bspry UTSW 4 62482667 missense possibly damaging 0.95
R4690:Bspry UTSW 4 62486525 missense probably damaging 0.98
R4735:Bspry UTSW 4 62486525 missense probably damaging 0.98
R5432:Bspry UTSW 4 62482715 missense probably benign 0.01
R5684:Bspry UTSW 4 62496282 missense possibly damaging 0.81
R7209:Bspry UTSW 4 62486615 missense possibly damaging 0.86
R7680:Bspry UTSW 4 62496591 makesense probably null
R7708:Bspry UTSW 4 62496100 missense probably benign 0.36
X0025:Bspry UTSW 4 62480198 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTACCTTGTGCATGGCTAG -3'
(R):5'- TGTTCAGCAGCACAGTGAG -3'

Sequencing Primer
(F):5'- CCTTGTGCATGGCTAGTATACAAC -3'
(R):5'- AGGGGGAATGTTTGTCACCC -3'
Posted On2015-02-05