Incidental Mutation 'R3038:Vmn2r16'
ID264878
Institutional Source Beutler Lab
Gene Symbol Vmn2r16
Ensembl Gene ENSMUSG00000092080
Gene Namevomeronasal 2, receptor 16
SynonymsEG384220
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109330381-109364481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109339333 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 140 (C140Y)
Ref Sequence ENSEMBL: ENSMUSP00000127838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165180]
Predicted Effect probably damaging
Transcript: ENSMUST00000165180
AA Change: C140Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127838
Gene: ENSMUSG00000092080
AA Change: C140Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.3e-28 PFAM
Pfam:NCD3G 509 563 8.2e-19 PFAM
Pfam:7tm_3 596 831 3.5e-56 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,496,983 I468V probably benign Het
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Ces1f T A 8: 93,256,598 N506I probably damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mrgpra1 G A 7: 47,334,996 Q312* probably null Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tmed9 A G 13: 55,596,979 K207E probably damaging Het
Tnfrsf19 A G 14: 60,972,063 S253P probably benign Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Vmn2r16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Vmn2r16 APN 5 109340428 missense probably damaging 1.00
IGL01374:Vmn2r16 APN 5 109330417 missense probably benign 0.00
IGL01391:Vmn2r16 APN 5 109363761 missense possibly damaging 0.50
IGL01419:Vmn2r16 APN 5 109362401 splice site probably benign
IGL01634:Vmn2r16 APN 5 109340311 missense probably benign 0.00
IGL01845:Vmn2r16 APN 5 109363896 missense probably damaging 1.00
IGL01875:Vmn2r16 APN 5 109330411 missense probably benign 0.01
IGL01910:Vmn2r16 APN 5 109340085 missense probably damaging 1.00
IGL02217:Vmn2r16 APN 5 109339810 missense probably damaging 0.98
IGL02327:Vmn2r16 APN 5 109340121 missense probably benign 0.01
IGL02491:Vmn2r16 APN 5 109339837 nonsense probably null
IGL02531:Vmn2r16 APN 5 109340268 missense probably damaging 0.99
IGL02680:Vmn2r16 APN 5 109340082 missense probably benign 0.44
IGL02884:Vmn2r16 APN 5 109360891 missense possibly damaging 0.94
IGL03084:Vmn2r16 APN 5 109330426 missense probably damaging 0.99
IGL03096:Vmn2r16 APN 5 109339885 missense probably damaging 0.99
IGL03355:Vmn2r16 APN 5 109363714 missense possibly damaging 0.74
R0280:Vmn2r16 UTSW 5 109340139 missense possibly damaging 0.88
R0594:Vmn2r16 UTSW 5 109363896 missense probably damaging 1.00
R1016:Vmn2r16 UTSW 5 109339888 missense probably damaging 1.00
R1109:Vmn2r16 UTSW 5 109339786 missense probably damaging 0.98
R1248:Vmn2r16 UTSW 5 109360777 missense probably benign 0.10
R1626:Vmn2r16 UTSW 5 109363577 missense probably damaging 1.00
R1909:Vmn2r16 UTSW 5 109363987 missense probably benign 0.01
R1929:Vmn2r16 UTSW 5 109339258 missense possibly damaging 0.92
R1982:Vmn2r16 UTSW 5 109364024 missense probably benign 0.01
R3437:Vmn2r16 UTSW 5 109330496 missense probably damaging 0.99
R3734:Vmn2r16 UTSW 5 109330414 missense probably benign 0.11
R3820:Vmn2r16 UTSW 5 109362277 missense probably benign 0.36
R3873:Vmn2r16 UTSW 5 109340311 missense probably benign 0.33
R4165:Vmn2r16 UTSW 5 109330561 missense possibly damaging 0.80
R4373:Vmn2r16 UTSW 5 109363801 missense probably damaging 1.00
R4575:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4576:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4578:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4637:Vmn2r16 UTSW 5 109330414 missense probably benign 0.00
R4696:Vmn2r16 UTSW 5 109339302 missense probably benign 0.01
R5026:Vmn2r16 UTSW 5 109360856 nonsense probably null
R5180:Vmn2r16 UTSW 5 109330525 missense probably benign 0.01
R5433:Vmn2r16 UTSW 5 109363842 missense probably damaging 1.00
R5955:Vmn2r16 UTSW 5 109363747 missense possibly damaging 0.78
R5958:Vmn2r16 UTSW 5 109362287 missense possibly damaging 0.81
R6353:Vmn2r16 UTSW 5 109340253 missense probably benign 0.33
R6389:Vmn2r16 UTSW 5 109330478 missense probably benign 0.19
R6819:Vmn2r16 UTSW 5 109340546 missense probably benign 0.04
R6994:Vmn2r16 UTSW 5 109340103 missense probably damaging 1.00
R7061:Vmn2r16 UTSW 5 109363754 missense probably damaging 0.99
R7063:Vmn2r16 UTSW 5 109363784 missense probably damaging 1.00
R7220:Vmn2r16 UTSW 5 109360906 missense probably damaging 0.97
R7268:Vmn2r16 UTSW 5 109340465 nonsense probably null
R7420:Vmn2r16 UTSW 5 109363870 missense probably damaging 0.96
R7591:Vmn2r16 UTSW 5 109362357 missense probably damaging 0.99
R7644:Vmn2r16 UTSW 5 109339971 missense probably damaging 1.00
R8023:Vmn2r16 UTSW 5 109340406 nonsense probably null
X0027:Vmn2r16 UTSW 5 109339309 missense probably damaging 1.00
Z1088:Vmn2r16 UTSW 5 109340515 missense probably benign 0.03
Z1088:Vmn2r16 UTSW 5 109363913 frame shift probably null
Z1177:Vmn2r16 UTSW 5 109339998 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCTGCCTTGTAGTACAAAGTTTAATGC -3'
(R):5'- GTGTTCTAGAAAACAGTTTTGCCTG -3'

Sequencing Primer
(F):5'- ATCCTTGTGCTTTTTAGAATACCAGC -3'
(R):5'- ACAGTTTTGCCTGTTTCTCCAC -3'
Posted On2015-02-05