Incidental Mutation 'R3038:Mrgpra1'
ID264879
Institutional Source Beutler Lab
Gene Symbol Mrgpra1
Ensembl Gene ENSMUSG00000050650
Gene NameMAS-related GPR, member A1
SynonymsMrgA1
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location47334875-47354240 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 47334996 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 312 (Q312*)
Ref Sequence ENSEMBL: ENSMUSP00000129978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098438]
Predicted Effect probably null
Transcript: ENSMUST00000098438
AA Change: Q312*
SMART Domains Protein: ENSMUSP00000129978
Gene: ENSMUSG00000050650
AA Change: Q312*

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 36 49 N/A INTRINSIC
Pfam:7tm_1 57 225 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,496,983 I468V probably benign Het
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Ces1f T A 8: 93,256,598 N506I probably damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tmed9 A G 13: 55,596,979 K207E probably damaging Het
Tnfrsf19 A G 14: 60,972,063 S253P probably benign Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vmn2r16 G A 5: 109,339,333 C140Y probably damaging Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Mrgpra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Mrgpra1 APN 7 47335578 missense probably benign 0.00
IGL01317:Mrgpra1 APN 7 47335624 missense probably benign 0.00
IGL01718:Mrgpra1 APN 7 47335927 splice site probably null
IGL02252:Mrgpra1 APN 7 47335164 missense probably benign 0.00
IGL03301:Mrgpra1 APN 7 47335416 missense probably benign
R0012:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R1019:Mrgpra1 UTSW 7 47335085 missense probably benign 0.00
R2224:Mrgpra1 UTSW 7 47335106 missense possibly damaging 0.50
R2520:Mrgpra1 UTSW 7 47335272 missense possibly damaging 0.75
R2924:Mrgpra1 UTSW 7 47334870 unclassified probably null
R3900:Mrgpra1 UTSW 7 47335527 missense possibly damaging 0.76
R4692:Mrgpra1 UTSW 7 47335698 missense probably damaging 1.00
R4783:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4784:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4785:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4981:Mrgpra1 UTSW 7 47335211 missense probably damaging 1.00
R5031:Mrgpra1 UTSW 7 47335237 nonsense probably null
R6760:Mrgpra1 UTSW 7 47335041 missense probably benign 0.03
R7305:Mrgpra1 UTSW 7 47335455 missense probably benign 0.38
R7348:Mrgpra1 UTSW 7 47335409 missense probably benign 0.09
R7837:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
R7920:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
X0012:Mrgpra1 UTSW 7 47335875 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCATGCCAAGTCGGTAAG -3'
(R):5'- TGGGCAGATAAAGCTTACCAG -3'

Sequencing Primer
(F):5'- CATGCCAAGTCGGTAAGCTGAG -3'
(R):5'- GCATCCACTGGTTTCTGTTATTCAAG -3'
Posted On2015-02-05