Incidental Mutation 'R3038:Ces1f'
ID264882
Institutional Source Beutler Lab
Gene Symbol Ces1f
Ensembl Gene ENSMUSG00000031725
Gene Namecarboxylesterase 1F
SynonymsTGH-2, CesML1
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93256236-93279747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93256598 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 506 (N506I)
Ref Sequence ENSEMBL: ENSMUSP00000034178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034178]
Predicted Effect probably damaging
Transcript: ENSMUST00000034178
AA Change: N506I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725
AA Change: N506I

DomainStartEndE-ValueType
Pfam:COesterase 1 545 2.5e-166 PFAM
Pfam:Abhydrolase_3 136 244 4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156737
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,496,983 I468V probably benign Het
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mrgpra1 G A 7: 47,334,996 Q312* probably null Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tmed9 A G 13: 55,596,979 K207E probably damaging Het
Tnfrsf19 A G 14: 60,972,063 S253P probably benign Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vmn2r16 G A 5: 109,339,333 C140Y probably damaging Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Ces1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ces1f APN 8 93267992 missense probably benign
IGL01143:Ces1f APN 8 93271830 critical splice donor site probably null
IGL01571:Ces1f APN 8 93258368 missense probably benign 0.00
IGL01731:Ces1f APN 8 93267320 missense possibly damaging 0.73
IGL01733:Ces1f APN 8 93270014 missense probably damaging 1.00
IGL02124:Ces1f APN 8 93265860 missense possibly damaging 0.54
IGL03058:Ces1f APN 8 93269972 critical splice donor site probably null
IGL03124:Ces1f APN 8 93275384 missense probably benign
3-1:Ces1f UTSW 8 93275431 missense probably benign 0.29
G5030:Ces1f UTSW 8 93274219 missense probably benign 0.03
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0113:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R0201:Ces1f UTSW 8 93267329 missense probably null 0.01
R0306:Ces1f UTSW 8 93276544 splice site probably benign
R0317:Ces1f UTSW 8 93263391 missense probably benign 0.05
R0558:Ces1f UTSW 8 93275389 missense probably benign
R0791:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R0833:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R0836:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R1087:Ces1f UTSW 8 93258295 missense probably damaging 1.00
R1118:Ces1f UTSW 8 93267242 splice site probably benign
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1183:Ces1f UTSW 8 93268005 missense probably benign 0.01
R1371:Ces1f UTSW 8 93279649 missense probably damaging 0.98
R1480:Ces1f UTSW 8 93274154 missense probably benign 0.07
R1522:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R1681:Ces1f UTSW 8 93275414 missense probably benign 0.00
R1865:Ces1f UTSW 8 93274265 splice site probably benign
R2437:Ces1f UTSW 8 93270139 splice site probably null
R4199:Ces1f UTSW 8 93256889 missense probably benign 0.00
R4406:Ces1f UTSW 8 93263322 missense probably benign
R5385:Ces1f UTSW 8 93265760 nonsense probably null
R5450:Ces1f UTSW 8 93265795 missense probably benign 0.04
R5627:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R6182:Ces1f UTSW 8 93256496 missense probably benign 0.43
R6256:Ces1f UTSW 8 93265794 missense probably damaging 1.00
R6379:Ces1f UTSW 8 93279651 missense probably benign
R6443:Ces1f UTSW 8 93275365 missense probably benign 0.00
R6967:Ces1f UTSW 8 93267997 missense probably benign 0.00
R7158:Ces1f UTSW 8 93268016 missense probably benign 0.00
R7323:Ces1f UTSW 8 93271844 missense probably damaging 1.00
R7654:Ces1f UTSW 8 93271934 missense probably benign 0.00
R7810:Ces1f UTSW 8 93256918 missense probably damaging 1.00
R7812:Ces1f UTSW 8 93258310 missense probably benign 0.00
R7864:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7947:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7999:Ces1f UTSW 8 93262995 missense possibly damaging 0.77
X0026:Ces1f UTSW 8 93270056 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAGAGCTTTGCATTCACAGCTC -3'
(R):5'- CCTTCAAGGTCTTCATTGGCATG -3'

Sequencing Primer
(F):5'- GCATTCACAGCTCATTGTGG -3'
(R):5'- CTCCTATGATGTACAGATGGC -3'
Posted On2015-02-05