Mutagenetix > Incidental Mutations

Incidental Mutation 'R3038:Ces1f'

264882

Institutional Source

Beutler Lab

Gene Symbol

Ces1f

Ensembl Gene

ENSMUSG00000031725

Gene Name

carboxylesterase 1F

Synonyms

TGH-2, CesML1

MMRRC Submission

040554-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R3038 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93256236-93279747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93256598 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 506 (N506I)

Ref Sequence

ENSEMBL: ENSMUSP00000034178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034178]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034178
AA Change: N506I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725
AA Change: N506I

Domain	Start	End	E-Value	Type
Pfam:COesterase	1	545	2.5e-166	PFAM
Pfam:Abhydrolase_3	136	244	4e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156737

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bspry	A	G	4: 62,496,983	I468V	probably benign	Het
Cavin2	T	A	1: 51,301,257	N364K	possibly damaging	Het
Dnhd1	A	T	7: 105,720,229	Q4353L	probably damaging	Het
Dsc3	T	C	18: 19,991,560	T36A	possibly damaging	Het
Hydin	A	G	8: 110,582,689	T4038A	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kif1b	T	C	4: 149,213,333	I1083V	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mrgpra1	G	A	7: 47,334,996	Q312*	probably null	Het
Pcdha1	T	A	18: 36,931,011	F243I	probably damaging	Het
Ppp1r18	T	C	17: 35,868,382	L383P	probably damaging	Het
Tmed9	A	G	13: 55,596,979	K207E	probably damaging	Het
Tnfrsf19	A	G	14: 60,972,063	S253P	probably benign	Het
Tspear	T	A	10: 77,886,439	Y624*	probably null	Het
Vmn2r16	G	A	5: 109,339,333	C140Y	probably damaging	Het
Vwa7	T	C	17: 35,022,661	V424A	probably damaging	Het
Zgpat	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	2: 181,366,018		probably benign	Het

Other mutations in Ces1f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ces1f	APN	8	93267992	missense	probably benign
IGL01143:Ces1f	APN	8	93271830	critical splice donor site	probably null
IGL01571:Ces1f	APN	8	93258368	missense	probably benign	0.00
IGL01731:Ces1f	APN	8	93267320	missense	possibly damaging	0.73
IGL01733:Ces1f	APN	8	93270014	missense	probably damaging	1.00
IGL02124:Ces1f	APN	8	93265860	missense	possibly damaging	0.54
IGL03058:Ces1f	APN	8	93269972	critical splice donor site	probably null
IGL03124:Ces1f	APN	8	93275384	missense	probably benign
3-1:Ces1f	UTSW	8	93275431	missense	probably benign	0.29
G5030:Ces1f	UTSW	8	93274219	missense	probably benign	0.03
R0025:Ces1f	UTSW	8	93271885	missense	probably benign	0.27
R0025:Ces1f	UTSW	8	93271885	missense	probably benign	0.27
R0113:Ces1f	UTSW	8	93279699	start codon destroyed	probably null	0.93
R0201:Ces1f	UTSW	8	93267329	missense	probably null	0.01
R0306:Ces1f	UTSW	8	93276544	splice site	probably benign
R0317:Ces1f	UTSW	8	93263391	missense	probably benign	0.05
R0558:Ces1f	UTSW	8	93275389	missense	probably benign
R0791:Ces1f	UTSW	8	93271889	missense	possibly damaging	0.52
R0833:Ces1f	UTSW	8	93270024	missense	probably damaging	0.98
R0836:Ces1f	UTSW	8	93270024	missense	probably damaging	0.98
R1087:Ces1f	UTSW	8	93258295	missense	probably damaging	1.00
R1118:Ces1f	UTSW	8	93267242	splice site	probably benign
R1147:Ces1f	UTSW	8	93258281	missense	possibly damaging	0.89
R1147:Ces1f	UTSW	8	93258281	missense	possibly damaging	0.89
R1183:Ces1f	UTSW	8	93268005	missense	probably benign	0.01
R1371:Ces1f	UTSW	8	93279649	missense	probably damaging	0.98
R1480:Ces1f	UTSW	8	93274154	missense	probably benign	0.07
R1522:Ces1f	UTSW	8	93271889	missense	possibly damaging	0.52
R1681:Ces1f	UTSW	8	93275414	missense	probably benign	0.00
R1865:Ces1f	UTSW	8	93274265	splice site	probably benign
R2437:Ces1f	UTSW	8	93270139	splice site	probably null
R4199:Ces1f	UTSW	8	93256889	missense	probably benign	0.00
R4406:Ces1f	UTSW	8	93263322	missense	probably benign
R5385:Ces1f	UTSW	8	93265760	nonsense	probably null
R5450:Ces1f	UTSW	8	93265795	missense	probably benign	0.04
R5627:Ces1f	UTSW	8	93279699	start codon destroyed	probably null	0.93
R6182:Ces1f	UTSW	8	93256496	missense	probably benign	0.43
R6256:Ces1f	UTSW	8	93265794	missense	probably damaging	1.00
R6379:Ces1f	UTSW	8	93279651	missense	probably benign
R6443:Ces1f	UTSW	8	93275365	missense	probably benign	0.00
R6967:Ces1f	UTSW	8	93267997	missense	probably benign	0.00
R7158:Ces1f	UTSW	8	93268016	missense	probably benign	0.00
R7323:Ces1f	UTSW	8	93271844	missense	probably damaging	1.00
R7654:Ces1f	UTSW	8	93271934	missense	probably benign	0.00
R7810:Ces1f	UTSW	8	93256918	missense	probably damaging	1.00
R7812:Ces1f	UTSW	8	93258310	missense	probably benign	0.00
R7864:Ces1f	UTSW	8	93274141	missense	possibly damaging	0.65
R7947:Ces1f	UTSW	8	93274141	missense	possibly damaging	0.65
R7999:Ces1f	UTSW	8	93262995	missense	possibly damaging	0.77
X0026:Ces1f	UTSW	8	93270056	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- CAGAGCTTTGCATTCACAGCTC -3'
(R):5'- CCTTCAAGGTCTTCATTGGCATG -3'

Sequencing Primer
(F):5'- GCATTCACAGCTCATTGTGG -3'
(R):5'- CTCCTATGATGTACAGATGGC -3'

Posted On

2015-02-05