Incidental Mutation 'R3038:Tmed9'
ID264885
Institutional Source Beutler Lab
Gene Symbol Tmed9
Ensembl Gene ENSMUSG00000058569
Gene Nametransmembrane p24 trafficking protein 9
Synonyms2400003B06Rik
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55573732-55597697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55596979 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 207 (K207E)
Ref Sequence ENSEMBL: ENSMUSP00000153554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064701] [ENSMUST00000100764] [ENSMUST00000109905] [ENSMUST00000133176] [ENSMUST00000224741]
Predicted Effect probably benign
Transcript: ENSMUST00000064701
SMART Domains Protein: ENSMUSP00000068532
Gene: ENSMUSG00000021504

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Glyco_transf_7N 62 177 8.5e-27 PFAM
Pfam:Glyco_transf_7C 181 260 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100764
SMART Domains Protein: ENSMUSP00000098327
Gene: ENSMUSG00000021504

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Glyco_transf_7N 72 180 9.2e-29 PFAM
Pfam:Glyco_transf_7C 181 263 1.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109905
AA Change: K233E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105531
Gene: ENSMUSG00000058569
AA Change: K233E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
EMP24_GP25L 37 230 2.43e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133176
SMART Domains Protein: ENSMUSP00000123292
Gene: ENSMUSG00000021504

DomainStartEndE-ValueType
Pfam:Glyco_transf_7N 18 124 1.1e-28 PFAM
Pfam:Glyco_transf_7C 125 204 5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224634
Predicted Effect probably damaging
Transcript: ENSMUST00000224741
AA Change: K207E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225888
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes encoding transport proteins located in the endoplasmic reticulum and the Golgi. A similar gene in mouse is the target of microRNA miR-296, which is part of an imprinted cluster. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,496,983 I468V probably benign Het
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Ces1f T A 8: 93,256,598 N506I probably damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mrgpra1 G A 7: 47,334,996 Q312* probably null Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tnfrsf19 A G 14: 60,972,063 S253P probably benign Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vmn2r16 G A 5: 109,339,333 C140Y probably damaging Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Tmed9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Tmed9 APN 13 55593521 missense probably benign 0.02
IGL02178:Tmed9 APN 13 55593295 missense possibly damaging 0.95
IGL03060:Tmed9 APN 13 55595508 missense possibly damaging 0.63
IGL03323:Tmed9 APN 13 55596878 missense probably damaging 0.98
R2190:Tmed9 UTSW 13 55593343 missense probably benign 0.01
R3413:Tmed9 UTSW 13 55595574 missense probably benign 0.01
R7298:Tmed9 UTSW 13 55593294 missense possibly damaging 0.52
R7751:Tmed9 UTSW 13 55593241 missense not run
R7800:Tmed9 UTSW 13 55595532 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGGGATCTTTGCAAGCTG -3'
(R):5'- CACTACTGGCTCAGCATTAGCC -3'

Sequencing Primer
(F):5'- TCTTTGCAAGCTGGGAACAC -3'
(R):5'- TCAGCATTAGCCAGCCAGG -3'
Posted On2015-02-05