Incidental Mutation 'R3038:Tnfrsf19'
ID264886
Institutional Source Beutler Lab
Gene Symbol Tnfrsf19
Ensembl Gene ENSMUSG00000060548
Gene Nametumor necrosis factor receptor superfamily, member 19
SynonymsTRADE, Troy, TAJ-ALPHA, TAJ
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60963875-61046490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60972063 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000106867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111234] [ENSMUST00000111236] [ENSMUST00000224371] [ENSMUST00000225730]
Predicted Effect probably benign
Transcript: ENSMUST00000111234
AA Change: S253P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106865
Gene: ENSMUSG00000060548
AA Change: S253P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111236
AA Change: S253P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106867
Gene: ENSMUSG00000060548
AA Change: S253P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225501
Predicted Effect probably benign
Transcript: ENSMUST00000225730
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit no obvious physical abnormalities or alterations in behavior, locomotion, or fecundity, however neurons are more resistant to the suppressive action of myelin inhibitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,496,983 I468V probably benign Het
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Ces1f T A 8: 93,256,598 N506I probably damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mrgpra1 G A 7: 47,334,996 Q312* probably null Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tmed9 A G 13: 55,596,979 K207E probably damaging Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vmn2r16 G A 5: 109,339,333 C140Y probably damaging Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Tnfrsf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Tnfrsf19 APN 14 61024182 missense possibly damaging 0.53
IGL01564:Tnfrsf19 APN 14 60974609 missense possibly damaging 0.85
IGL01878:Tnfrsf19 APN 14 60996644 missense probably damaging 0.98
IGL02220:Tnfrsf19 APN 14 60973492 unclassified probably benign
IGL02378:Tnfrsf19 APN 14 60971002 missense probably benign 0.00
IGL02546:Tnfrsf19 APN 14 60973538 missense possibly damaging 0.86
IGL02583:Tnfrsf19 APN 14 61024210 missense probably damaging 0.98
IGL03037:Tnfrsf19 APN 14 61024272 missense possibly damaging 0.83
IGL03221:Tnfrsf19 APN 14 61024778 missense probably benign 0.06
R0241:Tnfrsf19 UTSW 14 60973592 missense possibly damaging 0.93
R0373:Tnfrsf19 UTSW 14 60972036 missense possibly damaging 0.47
R1521:Tnfrsf19 UTSW 14 61005106 missense probably damaging 0.99
R4346:Tnfrsf19 UTSW 14 60971980 critical splice donor site probably null
R4997:Tnfrsf19 UTSW 14 60971209 missense probably benign
R5756:Tnfrsf19 UTSW 14 61024775 missense probably benign
R5869:Tnfrsf19 UTSW 14 60971178 missense possibly damaging 0.70
R6110:Tnfrsf19 UTSW 14 60971139 missense probably benign 0.08
R7047:Tnfrsf19 UTSW 14 61005218 nonsense probably null
R7266:Tnfrsf19 UTSW 14 60974698 missense possibly damaging 0.91
R7491:Tnfrsf19 UTSW 14 61005205 missense possibly damaging 0.75
R7729:Tnfrsf19 UTSW 14 60974734 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CTGCAGGGGACTCTTTTAGG -3'
(R):5'- GGTTAAGTCATCTGTCCGTCC -3'

Sequencing Primer
(F):5'- GGGACTCTTTTAGGTTCAAAGAAGTC -3'
(R):5'- CTCTTGCTTCAGTCTGGACAC -3'
Posted On2015-02-05