Incidental Mutation 'R3038:Tnfrsf19'
ID 264886
Institutional Source Beutler Lab
Gene Symbol Tnfrsf19
Ensembl Gene ENSMUSG00000060548
Gene Name tumor necrosis factor receptor superfamily, member 19
Synonyms TAJ, TRADE, TAJ-ALPHA, Troy
MMRRC Submission 040554-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3038 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 61201324-61283939 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61209512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000106867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111234] [ENSMUST00000111236] [ENSMUST00000224371] [ENSMUST00000225730]
AlphaFold Q9JLL3
Predicted Effect probably benign
Transcript: ENSMUST00000111234
AA Change: S253P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106865
Gene: ENSMUSG00000060548
AA Change: S253P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111236
AA Change: S253P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106867
Gene: ENSMUSG00000060548
AA Change: S253P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225501
Predicted Effect probably benign
Transcript: ENSMUST00000225730
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit no obvious physical abnormalities or alterations in behavior, locomotion, or fecundity, however neurons are more resistant to the suppressive action of myelin inhibitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,415,220 (GRCm39) I468V probably benign Het
Cavin2 T A 1: 51,340,416 (GRCm39) N364K possibly damaging Het
Ces1f T A 8: 93,983,226 (GRCm39) N506I probably damaging Het
Dnhd1 A T 7: 105,369,436 (GRCm39) Q4353L probably damaging Het
Dsc3 T C 18: 20,124,617 (GRCm39) T36A possibly damaging Het
Hydin A G 8: 111,309,321 (GRCm39) T4038A probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kif1b T C 4: 149,297,790 (GRCm39) I1083V probably benign Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Mrgpra1 G A 7: 46,984,744 (GRCm39) Q312* probably null Het
Pcdha1 T A 18: 37,064,064 (GRCm39) F243I probably damaging Het
Ppp1r18 T C 17: 36,179,274 (GRCm39) L383P probably damaging Het
Tmed9 A G 13: 55,744,792 (GRCm39) K207E probably damaging Het
Tspear T A 10: 77,722,273 (GRCm39) Y624* probably null Het
Vmn2r16 G A 5: 109,487,199 (GRCm39) C140Y probably damaging Het
Vwa7 T C 17: 35,241,637 (GRCm39) V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,007,811 (GRCm39) probably benign Het
Other mutations in Tnfrsf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Tnfrsf19 APN 14 61,261,631 (GRCm39) missense possibly damaging 0.53
IGL01564:Tnfrsf19 APN 14 61,212,058 (GRCm39) missense possibly damaging 0.85
IGL01878:Tnfrsf19 APN 14 61,234,093 (GRCm39) missense probably damaging 0.98
IGL02220:Tnfrsf19 APN 14 61,210,941 (GRCm39) unclassified probably benign
IGL02378:Tnfrsf19 APN 14 61,208,451 (GRCm39) missense probably benign 0.00
IGL02546:Tnfrsf19 APN 14 61,210,987 (GRCm39) missense possibly damaging 0.86
IGL02583:Tnfrsf19 APN 14 61,261,659 (GRCm39) missense probably damaging 0.98
IGL03037:Tnfrsf19 APN 14 61,261,721 (GRCm39) missense possibly damaging 0.83
IGL03221:Tnfrsf19 APN 14 61,262,227 (GRCm39) missense probably benign 0.06
R0241:Tnfrsf19 UTSW 14 61,211,041 (GRCm39) missense possibly damaging 0.93
R0373:Tnfrsf19 UTSW 14 61,209,485 (GRCm39) missense possibly damaging 0.47
R1521:Tnfrsf19 UTSW 14 61,242,555 (GRCm39) missense probably damaging 0.99
R4346:Tnfrsf19 UTSW 14 61,209,429 (GRCm39) critical splice donor site probably null
R4997:Tnfrsf19 UTSW 14 61,208,658 (GRCm39) missense probably benign
R5756:Tnfrsf19 UTSW 14 61,262,224 (GRCm39) missense probably benign
R5869:Tnfrsf19 UTSW 14 61,208,627 (GRCm39) missense possibly damaging 0.70
R6110:Tnfrsf19 UTSW 14 61,208,588 (GRCm39) missense probably benign 0.08
R7047:Tnfrsf19 UTSW 14 61,242,667 (GRCm39) nonsense probably null
R7266:Tnfrsf19 UTSW 14 61,212,147 (GRCm39) missense possibly damaging 0.91
R7491:Tnfrsf19 UTSW 14 61,242,654 (GRCm39) missense possibly damaging 0.75
R7729:Tnfrsf19 UTSW 14 61,212,183 (GRCm39) missense possibly damaging 0.70
R7936:Tnfrsf19 UTSW 14 61,208,382 (GRCm39) missense probably benign 0.22
R8358:Tnfrsf19 UTSW 14 61,208,634 (GRCm39) missense probably benign 0.25
R8535:Tnfrsf19 UTSW 14 61,208,417 (GRCm39) missense probably benign 0.25
R8693:Tnfrsf19 UTSW 14 61,208,451 (GRCm39) missense probably benign
R9028:Tnfrsf19 UTSW 14 61,242,650 (GRCm39) missense probably benign 0.26
R9468:Tnfrsf19 UTSW 14 61,261,623 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGCAGGGGACTCTTTTAGG -3'
(R):5'- GGTTAAGTCATCTGTCCGTCC -3'

Sequencing Primer
(F):5'- GGGACTCTTTTAGGTTCAAAGAAGTC -3'
(R):5'- CTCTTGCTTCAGTCTGGACAC -3'
Posted On 2015-02-05