Incidental Mutation 'R3038:Dsc3'
ID264889
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Namedesmocollin 3
Synonyms
MMRRC Submission 040554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3038 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location19960930-20002351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19991560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 36 (T36A)
Ref Sequence ENSEMBL: ENSMUSP00000153279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000223946] [ENSMUST00000225110]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115848
AA Change: T36A

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: T36A

DomainStartEndE-ValueType
Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223946
AA Change: T36A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225110
AA Change: T36A

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bspry A G 4: 62,496,983 I468V probably benign Het
Cavin2 T A 1: 51,301,257 N364K possibly damaging Het
Ces1f T A 8: 93,256,598 N506I probably damaging Het
Dnhd1 A T 7: 105,720,229 Q4353L probably damaging Het
Hydin A G 8: 110,582,689 T4038A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b T C 4: 149,213,333 I1083V probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mrgpra1 G A 7: 47,334,996 Q312* probably null Het
Pcdha1 T A 18: 36,931,011 F243I probably damaging Het
Ppp1r18 T C 17: 35,868,382 L383P probably damaging Het
Tmed9 A G 13: 55,596,979 K207E probably damaging Het
Tnfrsf19 A G 14: 60,972,063 S253P probably benign Het
Tspear T A 10: 77,886,439 Y624* probably null Het
Vmn2r16 G A 5: 109,339,333 C140Y probably damaging Het
Vwa7 T C 17: 35,022,661 V424A probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 19985631 missense probably null 1.00
IGL01978:Dsc3 APN 18 19974196 missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20001906 missense probably benign 0.01
IGL02165:Dsc3 APN 18 19983652 missense probably benign 0.06
IGL02543:Dsc3 APN 18 19965828 missense probably benign 0.11
IGL02970:Dsc3 APN 18 19968260 missense probably damaging 1.00
IGL03097:Dsc3 UTSW 18 19974048 missense probably benign 0.30
R0133:Dsc3 UTSW 18 19971582 missense probably damaging 0.96
R0304:Dsc3 UTSW 18 19981241 missense probably damaging 1.00
R0360:Dsc3 UTSW 18 19971582 missense possibly damaging 0.79
R0673:Dsc3 UTSW 18 19989590 missense probably damaging 1.00
R0826:Dsc3 UTSW 18 19981172 missense probably damaging 0.99
R1120:Dsc3 UTSW 18 19986977 missense probably benign 0.05
R1491:Dsc3 UTSW 18 19987034 missense probably damaging 0.99
R1667:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 19966227 missense probably damaging 1.00
R1792:Dsc3 UTSW 18 19986998 missense probably damaging 1.00
R1858:Dsc3 UTSW 18 19965716 missense probably damaging 0.97
R1965:Dsc3 UTSW 18 19980672 missense probably damaging 1.00
R1988:Dsc3 UTSW 18 19965846 missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 19989680 missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 19968354 missense probably benign 0.00
R2143:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 19965638 missense probably damaging 0.99
R3872:Dsc3 UTSW 18 19971508 missense probably damaging 0.99
R4229:Dsc3 UTSW 18 19965821 missense probably damaging 1.00
R4298:Dsc3 UTSW 18 19980754 missense possibly damaging 0.62
R4491:Dsc3 UTSW 18 20001865 missense probably benign 0.30
R4590:Dsc3 UTSW 18 19989695 missense probably damaging 1.00
R4615:Dsc3 UTSW 18 19971488 missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 19963541 missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 19989534 missense probably damaging 1.00
R5796:Dsc3 UTSW 18 19971501 missense probably benign 0.01
R5916:Dsc3 UTSW 18 19987020 missense probably damaging 1.00
R6022:Dsc3 UTSW 18 19966338 missense probably damaging 0.97
R6233:Dsc3 UTSW 18 19965795 missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 19966291 missense probably benign 0.05
R6971:Dsc3 UTSW 18 19966218 critical splice donor site probably null
R7261:Dsc3 UTSW 18 19980757 nonsense probably null
R7442:Dsc3 UTSW 18 19981156 missense probably damaging 1.00
R7795:Dsc3 UTSW 18 19966231 missense probably damaging 1.00
R8051:Dsc3 UTSW 18 19981213 missense probably damaging 1.00
X0061:Dsc3 UTSW 18 19989627 missense probably damaging 1.00
Z1177:Dsc3 UTSW 18 19966315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCTGATTCAGCATCTACAAGG -3'
(R):5'- CCCACTGAGCTTTGTTGGTGTC -3'

Sequencing Primer
(F):5'- GATTCAGCATCTACAAGGCAAAAATG -3'
(R):5'- GTCAGTTGAGCACAGACACTCTTTG -3'
Posted On2015-02-05