Incidental Mutation 'I1329:Rpe65'
ID 26489
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms rd12, Mord1, A930029L06Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # I1329 (G1) of strain toku
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 159304812-159330958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 159330360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 509 (D509G)
Ref Sequence ENSEMBL: ENSMUSP00000143654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
AlphaFold Q91ZQ5
Predicted Effect probably benign
Transcript: ENSMUST00000029824
AA Change: D509G

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: D509G

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196999
AA Change: D509G

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: D509G

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,863,631 (GRCm39) I28T possibly damaging Het
Agbl4 T A 4: 110,335,652 (GRCm39) probably benign Het
Aspscr1 G C 11: 120,592,066 (GRCm39) V268L probably damaging Het
Btbd10 A G 7: 112,932,082 (GRCm39) S115P probably benign Het
Cercam T A 2: 29,761,097 (GRCm39) V132E probably damaging Het
Decr1 G A 4: 15,930,976 (GRCm39) R119* probably null Het
Dlst T C 12: 85,170,615 (GRCm39) M248T probably damaging Het
Erbb3 T C 10: 128,419,323 (GRCm39) N215S possibly damaging Het
Flnc G A 6: 29,451,414 (GRCm39) V1543M probably damaging Het
Garre1 A G 7: 33,944,619 (GRCm39) S542P probably benign Het
Gk5 GCC GC 9: 96,022,682 (GRCm39) probably null Het
Glrb T A 3: 80,769,381 (GRCm39) R115S probably damaging Het
Gm5592 T A 7: 40,935,778 (GRCm39) Y93* probably null Het
Gpr20 C T 15: 73,567,612 (GRCm39) R259H probably damaging Het
Il1rap A G 16: 26,511,600 (GRCm39) T215A probably benign Het
Ipmk T C 10: 71,217,277 (GRCm39) C275R possibly damaging Het
Lats1 A G 10: 7,588,566 (GRCm39) N1061S probably benign Het
Nkain3 A G 4: 20,158,329 (GRCm39) probably benign Het
Nr1h4 A G 10: 89,319,224 (GRCm39) probably benign Het
Nr4a3 A G 4: 48,051,585 (GRCm39) Q142R probably benign Het
Otog G A 7: 45,895,927 (GRCm39) V131I probably benign Het
Parp12 A T 6: 39,064,505 (GRCm39) M627K probably damaging Het
Pcdh9 A G 14: 94,123,645 (GRCm39) S842P probably benign Het
Phc2 G C 4: 128,604,906 (GRCm39) G214A probably damaging Het
Prpf40a C A 2: 53,066,407 (GRCm39) V92L probably benign Het
Qser1 A T 2: 104,617,322 (GRCm39) Y1163* probably null Het
Scin T A 12: 40,123,329 (GRCm39) N518I probably damaging Het
Sfswap G T 5: 129,584,201 (GRCm39) probably benign Het
Tfpi A T 2: 84,274,460 (GRCm39) N182K possibly damaging Het
Tph1 A G 7: 46,299,437 (GRCm39) L368P probably damaging Het
Ttn T C 2: 76,571,916 (GRCm39) T26326A possibly damaging Het
Ubr1 G A 2: 120,764,775 (GRCm39) probably benign Het
Usf3 G T 16: 44,040,893 (GRCm39) C1791F probably damaging Het
Vmn1r16 T G 6: 57,300,519 (GRCm39) R34S probably damaging Het
Ylpm1 C A 12: 85,087,654 (GRCm39) P1604Q probably damaging Het
Zc3h12a A G 4: 125,013,157 (GRCm39) V569A possibly damaging Het
Zmynd8 A G 2: 165,670,145 (GRCm39) F488S probably damaging Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159,320,179 (GRCm39) missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159,306,042 (GRCm39) splice site probably benign
IGL01815:Rpe65 APN 3 159,310,167 (GRCm39) splice site probably null
IGL02085:Rpe65 APN 3 159,321,283 (GRCm39) missense probably benign 0.00
IGL02232:Rpe65 APN 3 159,309,988 (GRCm39) missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159,330,342 (GRCm39) missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159,312,128 (GRCm39) missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159,328,514 (GRCm39) missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159,305,998 (GRCm39) missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159,309,978 (GRCm39) missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159,320,154 (GRCm39) missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159,321,214 (GRCm39) missense possibly damaging 0.89
R0571:Rpe65 UTSW 3 159,305,986 (GRCm39) missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159,307,220 (GRCm39) missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159,312,122 (GRCm39) missense probably benign 0.07
R1597:Rpe65 UTSW 3 159,320,421 (GRCm39) missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159,320,085 (GRCm39) missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159,328,485 (GRCm39) missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159,321,307 (GRCm39) missense probably benign
R2259:Rpe65 UTSW 3 159,321,208 (GRCm39) missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159,310,200 (GRCm39) missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159,310,037 (GRCm39) missense probably benign 0.16
R3975:Rpe65 UTSW 3 159,310,222 (GRCm39) missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159,310,047 (GRCm39) missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159,330,318 (GRCm39) missense probably benign
R4924:Rpe65 UTSW 3 159,328,268 (GRCm39) missense probably benign 0.01
R5269:Rpe65 UTSW 3 159,309,984 (GRCm39) missense probably benign 0.07
R5324:Rpe65 UTSW 3 159,310,041 (GRCm39) missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159,310,038 (GRCm39) missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159,321,313 (GRCm39) missense probably benign
R5907:Rpe65 UTSW 3 159,321,319 (GRCm39) critical splice donor site probably null
R6149:Rpe65 UTSW 3 159,319,780 (GRCm39) missense probably benign
R6660:Rpe65 UTSW 3 159,320,345 (GRCm39) missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159,319,805 (GRCm39) missense probably benign 0.06
R7025:Rpe65 UTSW 3 159,328,322 (GRCm39) missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159,321,228 (GRCm39) missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159,328,491 (GRCm39) missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159,330,366 (GRCm39) missense probably benign 0.13
R7537:Rpe65 UTSW 3 159,310,246 (GRCm39) missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159,310,030 (GRCm39) missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159,320,342 (GRCm39) missense probably benign
R8179:Rpe65 UTSW 3 159,330,336 (GRCm39) missense probably benign 0.06
R8409:Rpe65 UTSW 3 159,319,785 (GRCm39) missense probably benign 0.01
R8558:Rpe65 UTSW 3 159,320,429 (GRCm39) missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159,321,292 (GRCm39) missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159,328,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTAGTCCAGGAAGAAAGGGTTTA -3'
(R):5'- GGTTTTGCCATTAGAAACATGTCTTGCT -3'

Sequencing Primer
(F):5'- ttggaggcagaggcagg -3'
(R):5'- gcaatgtgtgtgtagagatgaaag -3'
Posted On 2013-04-16