Mutagenetix > Incidental Mutation

Incidental Mutation 'R3039:B4galt3'

264890

Institutional Source

Beutler Lab

Gene Symbol

B4galt3

Ensembl Gene

ENSMUSG00000052423

Gene Name

UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3

Synonyms

ESTM26, 9530061M23Rik, beta4GalT-III, R74981

MMRRC Submission

040555-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.454) question?

Stock #

R3039 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171097898-171104468 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 171101613 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 196 (H196N)

Ref Sequence

ENSEMBL: ENSMUSP00000106945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141999] [ENSMUST00000192956] [ENSMUST00000141114] [ENSMUST00000151863]

AlphaFold

Q91YY2

Predicted Effect

probably damaging
Transcript: ENSMUST00000064272
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H196N

Domain	Start	End	E-Value	Type
transmembrane domain	12	31	N/A	INTRINSIC
low complexity region	61	77	N/A	INTRINSIC
Pfam:Glyco_transf_7N	79	212	1.7e-59	PFAM
Pfam:Glyco_transf_7C	217	294	6.3e-32	PFAM
low complexity region	348	364	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000073120

SMART Domains

Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

Domain	Start	End	E-Value	Type
Pfam:NAD_binding_8	7	74	1.3e-9	PFAM
Pfam:Amino_oxidase	12	471	1.7e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111313
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H196N

Domain	Start	End	E-Value	Type
transmembrane domain	12	31	N/A	INTRINSIC
low complexity region	61	77	N/A	INTRINSIC
Pfam:Glyco_transf_7N	79	214	2.1e-74	PFAM
Pfam:Glyco_transf_7C	217	294	1.7e-31	PFAM
Pfam:Glyco_tranf_2_2	238	298	1e-6	PFAM
low complexity region	348	364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123954

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125939

Predicted Effect

probably benign
Transcript: ENSMUST00000126699

SMART Domains

Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_7C	1	72	3.2e-28	PFAM
Pfam:Glyco_tranf_2_2	16	76	2.1e-5	PFAM
low complexity region	126	142	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129985

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138904

Predicted Effect

probably benign
Transcript: ENSMUST00000141999

SMART Domains

Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192956

SMART Domains

Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

Domain	Start	End	E-Value	Type
Pfam:NAD_binding_8	7	72	1.6e-7	PFAM
Pfam:Amino_oxidase	12	389	4.7e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141114

SMART Domains

Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

Domain	Start	End	E-Value	Type
low complexity region	86	102	N/A	INTRINSIC
Pfam:Glyco_transf_7N	104	139	2.6e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151863

Meta Mutation Damage Score

0.5682

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	T	A	5: 113,830,797 (GRCm39)	K64N	unknown	Het
Cap2	A	G	13: 46,793,317 (GRCm39)	N228D	probably benign	Het
Cd300ld	A	G	11: 114,877,003 (GRCm39)	S143P	probably benign	Het
Cmya5	A	G	13: 93,228,758 (GRCm39)	V2110A	probably benign	Het
Dusp29	A	G	14: 21,752,975 (GRCm39)	V57A	probably damaging	Het
Gpat3	T	C	5: 101,045,671 (GRCm39)	S432P	possibly damaging	Het
Lgi4	C	T	7: 30,759,492 (GRCm39)	A16V	probably benign	Het
Nsmce1	T	C	7: 125,070,328 (GRCm39)	E161G	probably damaging	Het
Pdgfa	A	G	5: 138,972,114 (GRCm39)	V95A	probably benign	Het
Pes1	T	C	11: 3,925,547 (GRCm39)	Y221H	probably damaging	Het
Phf19	T	C	2: 34,795,534 (GRCm39)	E179G	probably benign	Het
Rpap2	G	A	5: 107,749,661 (GRCm39)	V62I	possibly damaging	Het
Ush2a	T	C	1: 188,643,744 (GRCm39)	S4369P	probably damaging	Het
Wdr1	A	G	5: 38,687,428 (GRCm39)	I201T	possibly damaging	Het
Zhx1	T	C	15: 57,916,647 (GRCm39)	D533G	possibly damaging	Het

Other mutations in B4galt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02019:B4galt3	APN	1	171,099,362 (GRCm39)	missense	probably damaging	1.00
BB004:B4galt3	UTSW	1	171,099,342 (GRCm39)	nonsense	probably null
BB014:B4galt3	UTSW	1	171,099,342 (GRCm39)	nonsense	probably null
R0026:B4galt3	UTSW	1	171,101,831 (GRCm39)	unclassified	probably benign
R0126:B4galt3	UTSW	1	171,103,738 (GRCm39)	missense	probably damaging	0.97
R0537:B4galt3	UTSW	1	171,101,821 (GRCm39)	unclassified	probably benign
R1478:B4galt3	UTSW	1	171,103,938 (GRCm39)	missense	probably benign	0.11
R2012:B4galt3	UTSW	1	171,100,118 (GRCm39)	missense	probably damaging	1.00
R2206:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R2207:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R2223:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R2353:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R2354:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R2438:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R2439:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3051:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3709:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3710:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3741:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3742:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3813:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R3953:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4058:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4059:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4323:B4galt3	UTSW	1	171,103,515 (GRCm39)	missense	possibly damaging	0.93
R4367:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4368:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4370:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4371:B4galt3	UTSW	1	171,101,613 (GRCm39)	missense	probably damaging	1.00
R4486:B4galt3	UTSW	1	171,099,343 (GRCm39)	missense	possibly damaging	0.94
R4538:B4galt3	UTSW	1	171,100,280 (GRCm39)	missense	probably damaging	1.00
R5557:B4galt3	UTSW	1	171,100,089 (GRCm39)	critical splice acceptor site	probably null
R7313:B4galt3	UTSW	1	171,100,319 (GRCm39)	missense	probably damaging	1.00
R7927:B4galt3	UTSW	1	171,099,342 (GRCm39)	nonsense	probably null
R8222:B4galt3	UTSW	1	171,100,253 (GRCm39)	missense	possibly damaging	0.46
R8552:B4galt3	UTSW	1	171,101,917 (GRCm39)	missense	possibly damaging	0.70
R8804:B4galt3	UTSW	1	171,103,947 (GRCm39)	missense	probably benign	0.33
R8859:B4galt3	UTSW	1	171,099,241 (GRCm39)	missense	unknown
R9150:B4galt3	UTSW	1	171,103,899 (GRCm39)	missense	probably benign
R9265:B4galt3	UTSW	1	171,101,617 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTGGGTGCTCTCTTCACT -3'
(R):5'- TCCGCCAAAGTACTGGGG -3'

Sequencing Primer
(F):5'- GGGTGCTCTCTTCACTTTGGC -3'
(R):5'- AGATCCCTGCGGTTCACAAATTTG -3'

Posted On

2015-02-05