Incidental Mutation 'R3040:Bahd1'
ID264910
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
MMRRC Submission 040556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3040 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118916406 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 169 (P169S)
Ref Sequence ENSEMBL: ENSMUSP00000118998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000151162]
Predicted Effect probably benign
Transcript: ENSMUST00000036578
AA Change: P169S

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: P169S

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151162
AA Change: P169S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118998
Gene: ENSMUSG00000040007
AA Change: P169S

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 A C 9: 14,572,773 V498G probably benign Het
Ampd2 A G 3: 108,076,416 Y602H probably damaging Het
Ccar1 G T 10: 62,756,494 H760N possibly damaging Het
Cyp2c50 A G 19: 40,098,126 N319S probably benign Het
Dcdc2c G C 12: 28,552,182 A41G probably damaging Het
Dzip3 G A 16: 48,928,324 S1083F probably damaging Het
Etfdh C T 3: 79,604,919 R498Q probably damaging Het
Fam198b T A 3: 79,887,125 I300N possibly damaging Het
Fbn2 A T 18: 58,093,387 C772S probably damaging Het
Gdap2 T C 3: 100,188,035 probably null Het
Gm10436 A T 12: 88,178,348 S69R probably benign Het
Iqcj T C 3: 68,055,342 S79P probably damaging Het
Isg20l2 T C 3: 87,931,995 V171A probably benign Het
Kcna7 GGCTGCGCGGTGCCGCCCGAGCGGCCGCTGC GGCTGC 7: 45,406,788 probably null Het
Luc7l A T 17: 26,277,619 probably benign Het
Mepe T G 5: 104,338,122 L376R probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nedd4 T C 9: 72,669,961 F23L probably benign Het
Neurl1a T C 19: 47,239,831 S22P probably benign Het
Psmd2 T C 16: 20,657,567 V470A probably benign Het
Pyroxd2 G T 19: 42,735,518 Q323K probably benign Het
Slf2 A G 19: 44,980,569 D1157G probably damaging Het
Styxl1 C T 5: 135,757,033 A197T probably damaging Het
Tmem70 C T 1: 16,667,765 T100M possibly damaging Het
Trip12 A G 1: 84,742,245 V309A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn1r122 G C 7: 21,133,446 P228R probably benign Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R0932:Bahd1 UTSW 2 118915927 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2846:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2985:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3033:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3432:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3617:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCGCCTGGAAAACGTG -3'
(R):5'- GACAGTTCTTGCCGTTGACC -3'

Sequencing Primer
(F):5'- CCAGTGAGGATGCTGGTCTC -3'
(R):5'- TTGACCTTTGGCCGCAG -3'
Posted On2015-02-05