Incidental Mutation 'R3040:Styxl1'
ID264918
Institutional Source Beutler Lab
Gene Symbol Styxl1
Ensembl Gene ENSMUSG00000019178
Gene Nameserine/threonine/tyrosine interacting-like 1
Synonyms1700011C14Rik, Dusp24
MMRRC Submission 040556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3040 (G1)
Quality Score83
Status Not validated
Chromosome5
Chromosomal Location135747220-135778385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135757033 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 197 (A197T)
Ref Sequence ENSEMBL: ENSMUSP00000135982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053906] [ENSMUST00000111161] [ENSMUST00000111162] [ENSMUST00000111163] [ENSMUST00000111164] [ENSMUST00000142343] [ENSMUST00000177559] [ENSMUST00000178515] [ENSMUST00000178796]
Predicted Effect probably damaging
Transcript: ENSMUST00000053906
AA Change: A197T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051216
Gene: ENSMUSG00000019178
AA Change: A197T

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111161
AA Change: A53T

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106791
Gene: ENSMUSG00000019178
AA Change: A53T

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111162
SMART Domains Protein: ENSMUSP00000106792
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
Pfam:DSPc 64 203 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111163
AA Change: A197T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106793
Gene: ENSMUSG00000019178
AA Change: A197T

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111164
AA Change: A197T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106794
Gene: ENSMUSG00000019178
AA Change: A197T

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142343
SMART Domains Protein: ENSMUSP00000136983
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
Blast:RHOD 17 62 8e-19 BLAST
SCOP:d1gmxa_ 23 67 6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177559
AA Change: A197T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135982
Gene: ENSMUSG00000019178
AA Change: A197T

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178515
AA Change: A53T

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137191
Gene: ENSMUSG00000019178
AA Change: A53T

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178796
SMART Domains Protein: ENSMUSP00000137481
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
RHOD 27 158 1.31e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 A C 9: 14,572,773 V498G probably benign Het
Ampd2 A G 3: 108,076,416 Y602H probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Ccar1 G T 10: 62,756,494 H760N possibly damaging Het
Cyp2c50 A G 19: 40,098,126 N319S probably benign Het
Dcdc2c G C 12: 28,552,182 A41G probably damaging Het
Dzip3 G A 16: 48,928,324 S1083F probably damaging Het
Etfdh C T 3: 79,604,919 R498Q probably damaging Het
Fam198b T A 3: 79,887,125 I300N possibly damaging Het
Fbn2 A T 18: 58,093,387 C772S probably damaging Het
Gdap2 T C 3: 100,188,035 probably null Het
Gm10436 A T 12: 88,178,348 S69R probably benign Het
Iqcj T C 3: 68,055,342 S79P probably damaging Het
Isg20l2 T C 3: 87,931,995 V171A probably benign Het
Kcna7 GGCTGCGCGGTGCCGCCCGAGCGGCCGCTGC GGCTGC 7: 45,406,788 probably null Het
Luc7l A T 17: 26,277,619 probably benign Het
Mepe T G 5: 104,338,122 L376R probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nedd4 T C 9: 72,669,961 F23L probably benign Het
Neurl1a T C 19: 47,239,831 S22P probably benign Het
Psmd2 T C 16: 20,657,567 V470A probably benign Het
Pyroxd2 G T 19: 42,735,518 Q323K probably benign Het
Slf2 A G 19: 44,980,569 D1157G probably damaging Het
Tmem70 C T 1: 16,667,765 T100M possibly damaging Het
Trip12 A G 1: 84,742,245 V309A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn1r122 G C 7: 21,133,446 P228R probably benign Het
Other mutations in Styxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Styxl1 APN 5 135765750 missense probably damaging 1.00
IGL02735:Styxl1 APN 5 135759142 missense probably damaging 1.00
IGL03284:Styxl1 APN 5 135757095 missense possibly damaging 0.65
R1263:Styxl1 UTSW 5 135753883 missense probably damaging 1.00
R1533:Styxl1 UTSW 5 135770321 missense probably damaging 1.00
R1987:Styxl1 UTSW 5 135757122 missense probably damaging 1.00
R2399:Styxl1 UTSW 5 135747781 missense possibly damaging 0.80
R3411:Styxl1 UTSW 5 135765764 missense probably damaging 1.00
R4085:Styxl1 UTSW 5 135759165 missense unknown
R4772:Styxl1 UTSW 5 135768901 nonsense probably null
R5667:Styxl1 UTSW 5 135757123 unclassified probably null
R6376:Styxl1 UTSW 5 135747810 missense probably benign 0.04
R6601:Styxl1 UTSW 5 135755496 missense probably benign 0.30
R7588:Styxl1 UTSW 5 135770276 missense probably damaging 0.98
R7735:Styxl1 UTSW 5 135759169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTAACCTAGAACAGAAGCCTG -3'
(R):5'- GCCTCCCAATTATCTTTGGTGAG -3'

Sequencing Primer
(F):5'- CCAAACTTTCTGGTTAGGCAG -3'
(R):5'- CCCAATTATCTTTGGTGAGTGTACAC -3'
Posted On2015-02-05