Mutagenetix > Incidental Mutations

Incidental Mutation 'I1329:Nr4a3'

26492

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

I1329 (G1) of strain toku

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48051585 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 142 (Q142R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably benign
Transcript: ENSMUST00000030025
AA Change: Q113R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: Q113R

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133539

Predicted Effect

probably benign
Transcript: ENSMUST00000153369
AA Change: Q142R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: Q142R

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154186

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 95.2%

Validation Efficiency

89% (42/47)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,194	S542P	probably benign	Het
Adamts13	T	C	2: 26,973,619	I28T	possibly damaging	Het
Agbl4	T	A	4: 110,478,455		probably benign	Het
Aspscr1	G	C	11: 120,701,240	V268L	probably damaging	Het
Btbd10	A	G	7: 113,332,875	S115P	probably benign	Het
Cercam	T	A	2: 29,871,085	V132E	probably damaging	Het
Decr1	G	A	4: 15,930,976	R119*	probably null	Het
Dlst	T	C	12: 85,123,841	M248T	probably damaging	Het
Erbb3	T	C	10: 128,583,454	N215S	possibly damaging	Het
Flnc	G	A	6: 29,451,415	V1543M	probably damaging	Het
Gk5	GCC	GC	9: 96,140,629		probably null	Het
Glrb	T	A	3: 80,862,074	R115S	probably damaging	Het
Gm5592	T	A	7: 41,286,354	Y93*	probably null	Het
Gpr20	C	T	15: 73,695,763	R259H	probably damaging	Het
Il1rap	A	G	16: 26,692,850	T215A	probably benign	Het
Ipmk	T	C	10: 71,381,447	C275R	possibly damaging	Het
Lats1	A	G	10: 7,712,802	N1061S	probably benign	Het
Nkain3	A	G	4: 20,158,329		probably benign	Het
Nr1h4	A	G	10: 89,483,362		probably benign	Het
Otog	G	A	7: 46,246,503	V131I	probably benign	Het
Parp12	A	T	6: 39,087,571	M627K	probably damaging	Het
Pcdh9	A	G	14: 93,886,209	S842P	probably benign	Het
Phc2	G	C	4: 128,711,113	G214A	probably damaging	Het
Prpf40a	C	A	2: 53,176,395	V92L	probably benign	Het
Qser1	A	T	2: 104,786,977	Y1163*	probably null	Het
Rpe65	A	G	3: 159,624,723	D509G	probably benign	Het
Scin	T	A	12: 40,073,330	N518I	probably damaging	Het
Sfswap	G	T	5: 129,507,137		probably benign	Het
Tfpi	A	T	2: 84,444,116	N182K	possibly damaging	Het
Tph1	A	G	7: 46,650,013	L368P	probably damaging	Het
Ttn	T	C	2: 76,741,572	T26326A	possibly damaging	Het
Ubr1	G	A	2: 120,934,294		probably benign	Het
Usf3	G	T	16: 44,220,530	C1791F	probably damaging	Het
Vmn1r16	T	G	6: 57,323,534	R34S	probably damaging	Het
Ylpm1	C	A	12: 85,040,880	P1604Q	probably damaging	Het
Zc3h12a	A	G	4: 125,119,364	V569A	possibly damaging	Het
Zmynd8	A	G	2: 165,828,225	F488S	probably damaging	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- ACATCCCTGCCCAGCTTCAGTA -3'
(R):5'- CATGTGCCTTCCCCAGATGATGAG -3'

Sequencing Primer
(F):5'- GCCCAGCTTCAGTACCTTC -3'
(R):5'- GGCAGACTGAGTGCAGC -3'

Posted On

2013-04-16