Incidental Mutation 'R3040:Gm10436'
ID264926
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
MMRRC Submission 040556-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3040 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88178348 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 69 (S69R)
Ref Sequence ENSEMBL: ENSMUSP00000152194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect probably benign
Transcript: ENSMUST00000071580
AA Change: S77R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: S77R

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220521
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably benign
Transcript: ENSMUST00000222081
AA Change: S69R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect unknown
Transcript: ENSMUST00000222556
AA Change: S68R
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 A C 9: 14,572,773 V498G probably benign Het
Ampd2 A G 3: 108,076,416 Y602H probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Ccar1 G T 10: 62,756,494 H760N possibly damaging Het
Cyp2c50 A G 19: 40,098,126 N319S probably benign Het
Dcdc2c G C 12: 28,552,182 A41G probably damaging Het
Dzip3 G A 16: 48,928,324 S1083F probably damaging Het
Etfdh C T 3: 79,604,919 R498Q probably damaging Het
Fam198b T A 3: 79,887,125 I300N possibly damaging Het
Fbn2 A T 18: 58,093,387 C772S probably damaging Het
Gdap2 T C 3: 100,188,035 probably null Het
Iqcj T C 3: 68,055,342 S79P probably damaging Het
Isg20l2 T C 3: 87,931,995 V171A probably benign Het
Kcna7 GGCTGCGCGGTGCCGCCCGAGCGGCCGCTGC GGCTGC 7: 45,406,788 probably null Het
Luc7l A T 17: 26,277,619 probably benign Het
Mepe T G 5: 104,338,122 L376R probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nedd4 T C 9: 72,669,961 F23L probably benign Het
Neurl1a T C 19: 47,239,831 S22P probably benign Het
Psmd2 T C 16: 20,657,567 V470A probably benign Het
Pyroxd2 G T 19: 42,735,518 Q323K probably benign Het
Slf2 A G 19: 44,980,569 D1157G probably damaging Het
Styxl1 C T 5: 135,757,033 A197T probably damaging Het
Tmem70 C T 1: 16,667,765 T100M possibly damaging Het
Trip12 A G 1: 84,742,245 V309A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn1r122 G C 7: 21,133,446 P228R probably benign Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1279:Gm10436 UTSW 12 88175880 missense probably benign 0.42
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R2412:Gm10436 UTSW 12 88177110 missense probably damaging 0.98
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5601:Gm10436 UTSW 12 88176047 missense probably damaging 1.00
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
R6656:Gm10436 UTSW 12 88175993 missense possibly damaging 0.89
R7307:Gm10436 UTSW 12 88181749 missense probably damaging 1.00
R7332:Gm10436 UTSW 12 88176417 missense possibly damaging 0.72
R7544:Gm10436 UTSW 12 88176080 missense probably benign 0.00
R7569:Gm10436 UTSW 12 88176315 missense probably benign
R7645:Gm10436 UTSW 12 88176258 missense probably damaging 1.00
R7752:Gm10436 UTSW 12 88175999 missense probably damaging 1.00
R7855:Gm10436 UTSW 12 88176083 missense probably benign 0.03
R7860:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R8113:Gm10436 UTSW 12 88177080 missense probably benign 0.00
R8356:Gm10436 UTSW 12 88177216 missense probably benign 0.01
R8456:Gm10436 UTSW 12 88177216 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACCTTTTGTGCAAGCAG -3'
(R):5'- ATCGGTAGTGATCTAGCCCTCAC -3'

Sequencing Primer
(F):5'- GTGCAAGCAGTATATCTAGTCCC -3'
(R):5'- GGTAGTGATCTAGCCCTCACACTTC -3'
Posted On2015-02-05