Incidental Mutation 'R3051:Ceacam20'
ID264945
Institutional Source Beutler Lab
Gene Symbol Ceacam20
Ensembl Gene ENSMUSG00000070777
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 20
Synonyms
MMRRC Submission 040560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3051 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19965412-19991104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19976185 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 378 (V378E)
Ref Sequence ENSEMBL: ENSMUSP00000092344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094753]
Predicted Effect probably benign
Transcript: ENSMUST00000094753
AA Change: V378E

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092344
Gene: ENSMUSG00000070777
AA Change: V378E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 57 139 1.4e-7 SMART
IGc2 162 220 1.68e-5 SMART
IG 244 326 1.85e-7 SMART
IGc2 349 406 4.67e-4 SMART
transmembrane domain 431 453 N/A INTRINSIC
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207248
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik G A X: 89,754,103 V514I probably damaging Het
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Akap6 T C 12: 52,887,033 L436P probably damaging Het
Axin1 A G 17: 26,190,125 T700A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc178 T A 18: 22,135,131 M100L probably benign Het
Cwf19l2 G A 9: 3,410,006 R45H probably benign Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Ddr2 T C 1: 169,988,455 K561R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ltf A G 9: 111,024,522 D280G probably benign Het
Nlrc5 A G 8: 94,476,715 E481G probably benign Het
Olfr390 A G 11: 73,787,234 T99A probably benign Het
Pald1 G A 10: 61,346,763 Q412* probably null Het
Ptprd A G 4: 76,100,630 Y649H probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rbfox3 G T 11: 118,502,888 A37D probably damaging Het
Rpa2 A G 4: 132,775,126 probably null Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc6a7 G A 18: 61,009,517 T41M probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Ten1 T C 11: 116,205,730 F70S possibly damaging Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tktl1 A G X: 74,177,404 T39A probably benign Het
Tmem51 A T 4: 142,032,024 Y138N probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Trpm1 G A 7: 64,269,101 E730K probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zfp345 T C 2: 150,474,852 N12D probably benign Het
Other mutations in Ceacam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Ceacam20 APN 7 19974274 missense probably damaging 1.00
IGL01574:Ceacam20 APN 7 19974322 missense possibly damaging 0.48
IGL02407:Ceacam20 APN 7 19970407 missense probably benign 0.26
IGL03035:Ceacam20 APN 7 19977908 critical splice donor site probably null
IGL03144:Ceacam20 APN 7 19971519 missense possibly damaging 0.65
R0129:Ceacam20 UTSW 7 19976260 missense probably damaging 1.00
R0573:Ceacam20 UTSW 7 19986668 missense probably damaging 0.97
R0616:Ceacam20 UTSW 7 19970396 missense probably benign 0.01
R1016:Ceacam20 UTSW 7 19976302 missense probably null
R1218:Ceacam20 UTSW 7 19976097 missense probably benign 0.00
R1257:Ceacam20 UTSW 7 19974192 missense probably benign 0.03
R2334:Ceacam20 UTSW 7 19971591 missense probably damaging 1.00
R4184:Ceacam20 UTSW 7 19976116 missense probably damaging 1.00
R4667:Ceacam20 UTSW 7 19986027 missense probably damaging 1.00
R4668:Ceacam20 UTSW 7 19986027 missense probably damaging 1.00
R4669:Ceacam20 UTSW 7 19986027 missense probably damaging 1.00
R4953:Ceacam20 UTSW 7 19971726 missense probably damaging 1.00
R5000:Ceacam20 UTSW 7 19965528 missense probably damaging 0.98
R5450:Ceacam20 UTSW 7 19978208 missense possibly damaging 0.94
R5561:Ceacam20 UTSW 7 19970393 missense possibly damaging 0.90
R6118:Ceacam20 UTSW 7 19971729 missense possibly damaging 0.90
R6414:Ceacam20 UTSW 7 19976131 missense probably damaging 1.00
R6970:Ceacam20 UTSW 7 19989977 missense probably damaging 1.00
R7220:Ceacam20 UTSW 7 19967753 missense probably damaging 0.99
R7426:Ceacam20 UTSW 7 19970234 missense probably damaging 1.00
Z1177:Ceacam20 UTSW 7 19970164 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGACTTTGCAGATGGCCC -3'
(R):5'- AGTCGACGTCACACTTAATGC -3'

Sequencing Primer
(F):5'- AGATGGCCCCGACCAAGTG -3'
(R):5'- GACGTCACACTTAATGCCATGATAG -3'
Posted On2015-02-05