Incidental Mutation 'R3051:Acsl1'
ID264952
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission 040560-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R3051 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46521337 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 330 (V330I)
Ref Sequence ENSEMBL: ENSMUSP00000106001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372]
Predicted Effect probably benign
Transcript: ENSMUST00000034046
AA Change: V330I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796
AA Change: V330I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110371
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110372
AA Change: V330I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796
AA Change: V330I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210929
Meta Mutation Damage Score 0.1235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik G A X: 89,754,103 V514I probably damaging Het
Akap6 T C 12: 52,887,033 L436P probably damaging Het
Axin1 A G 17: 26,190,125 T700A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc178 T A 18: 22,135,131 M100L probably benign Het
Ceacam20 T A 7: 19,976,185 V378E probably benign Het
Cwf19l2 G A 9: 3,410,006 R45H probably benign Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Ddr2 T C 1: 169,988,455 K561R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ltf A G 9: 111,024,522 D280G probably benign Het
Nlrc5 A G 8: 94,476,715 E481G probably benign Het
Olfr390 A G 11: 73,787,234 T99A probably benign Het
Pald1 G A 10: 61,346,763 Q412* probably null Het
Ptprd A G 4: 76,100,630 Y649H probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rbfox3 G T 11: 118,502,888 A37D probably damaging Het
Rpa2 A G 4: 132,775,126 probably null Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc6a7 G A 18: 61,009,517 T41M probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Ten1 T C 11: 116,205,730 F70S possibly damaging Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tktl1 A G X: 74,177,404 T39A probably benign Het
Tmem51 A T 4: 142,032,024 Y138N probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Trpm1 G A 7: 64,269,101 E730K probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zfp345 T C 2: 150,474,852 N12D probably benign Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 intron probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R2167:Acsl1 UTSW 8 46533590 missense possibly damaging 0.91
R3052:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R3956:Acsl1 UTSW 8 46534458 missense probably damaging 1.00
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5012:Acsl1 UTSW 8 46521431 missense probably benign 0.01
R5168:Acsl1 UTSW 8 46513266 unclassified probably benign
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7151:Acsl1 UTSW 8 46513597 missense probably damaging 1.00
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
R7914:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTATGCTTGGTCATCAG -3'
(R):5'- TTCCAACAACCTGTGCTGC -3'

Sequencing Primer
(F):5'- GGTAGAGCACTTCTTAACATGTGCAC -3'
(R):5'- CCGAGTGAAGAACCGTGTGTATG -3'
Posted On2015-02-05