Incidental Mutation 'R3051:Ltf'
ID264957
Institutional Source Beutler Lab
Gene Symbol Ltf
Ensembl Gene ENSMUSG00000032496
Gene Namelactotransferrin
SynonymsLf, lactoferrin
MMRRC Submission 040560-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3051 (G1)
Quality Score168
Status Validated
Chromosome9
Chromosomal Location111019271-111042767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111024522 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 280 (D280G)
Ref Sequence ENSEMBL: ENSMUSP00000035077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035077] [ENSMUST00000196122] [ENSMUST00000196209] [ENSMUST00000196777] [ENSMUST00000198884]
Predicted Effect probably benign
Transcript: ENSMUST00000035077
AA Change: D280G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035077
Gene: ENSMUSG00000032496
AA Change: D280G

DomainStartEndE-ValueType
TR_FER 24 362 1.48e-209 SMART
TR_FER 363 696 4.68e-212 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196122
SMART Domains Protein: ENSMUSP00000143234
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 4 183 6.4e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196209
SMART Domains Protein: ENSMUSP00000143731
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
Pfam:Transferrin 13 78 3.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196777
SMART Domains Protein: ENSMUSP00000143629
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 121 2.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197893
Predicted Effect probably benign
Transcript: ENSMUST00000198152
Predicted Effect probably benign
Transcript: ENSMUST00000198884
SMART Domains Protein: ENSMUSP00000142432
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 95 4.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200459
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and grossly normal and exhibit only minor alterations in iron homeostasis. Mice homozygous for a different knock-out allele show increased susceptibility to inflammation-induced colorectal dysplasia along with increased cell proliferation and decreased apoptosis in colonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik G A X: 89,754,103 V514I probably damaging Het
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Akap6 T C 12: 52,887,033 L436P probably damaging Het
Axin1 A G 17: 26,190,125 T700A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc178 T A 18: 22,135,131 M100L probably benign Het
Ceacam20 T A 7: 19,976,185 V378E probably benign Het
Cwf19l2 G A 9: 3,410,006 R45H probably benign Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Ddr2 T C 1: 169,988,455 K561R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Nlrc5 A G 8: 94,476,715 E481G probably benign Het
Olfr390 A G 11: 73,787,234 T99A probably benign Het
Pald1 G A 10: 61,346,763 Q412* probably null Het
Ptprd A G 4: 76,100,630 Y649H probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rbfox3 G T 11: 118,502,888 A37D probably damaging Het
Rpa2 A G 4: 132,775,126 probably null Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc6a7 G A 18: 61,009,517 T41M probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Ten1 T C 11: 116,205,730 F70S possibly damaging Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tktl1 A G X: 74,177,404 T39A probably benign Het
Tmem51 A T 4: 142,032,024 Y138N probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Trpm1 G A 7: 64,269,101 E730K probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zfp345 T C 2: 150,474,852 N12D probably benign Het
Other mutations in Ltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ltf APN 9 111022882 intron probably null
IGL01068:Ltf APN 9 111035812 unclassified probably null
IGL01311:Ltf APN 9 111031012 unclassified probably benign
IGL01629:Ltf APN 9 111035806 missense probably damaging 1.00
IGL01765:Ltf APN 9 111022017 missense possibly damaging 0.86
IGL02376:Ltf APN 9 111029624 missense probably benign 0.01
IGL02429:Ltf APN 9 111026125 missense possibly damaging 0.87
IGL02947:Ltf APN 9 111038947 missense probably benign 0.01
IGL03025:Ltf APN 9 111025101 missense possibly damaging 0.93
R0041:Ltf UTSW 9 111029568 missense possibly damaging 0.92
R0364:Ltf UTSW 9 111025167 missense probably benign 0.19
R0718:Ltf UTSW 9 111040379 missense probably benign 0.01
R1899:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R1900:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R2964:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2965:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2966:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R3122:Ltf UTSW 9 111022900 missense probably damaging 1.00
R4427:Ltf UTSW 9 111023604 missense probably damaging 1.00
R4597:Ltf UTSW 9 111022933 missense probably damaging 1.00
R4604:Ltf UTSW 9 111022341 missense probably damaging 0.99
R4827:Ltf UTSW 9 111027377 unclassified probably benign
R4849:Ltf UTSW 9 111025990 missense probably benign 0.00
R5389:Ltf UTSW 9 111029651 missense possibly damaging 0.50
R5677:Ltf UTSW 9 111020912 start codon destroyed probably null 0.01
R6419:Ltf UTSW 9 111031022 missense possibly damaging 0.67
R6891:Ltf UTSW 9 111025113 missense probably benign 0.13
R7032:Ltf UTSW 9 111026130 critical splice donor site probably null
R7090:Ltf UTSW 9 111025980 missense probably benign 0.00
R7352:Ltf UTSW 9 111028450 missense probably benign
R7857:Ltf UTSW 9 111022376 missense probably benign 0.00
R7940:Ltf UTSW 9 111022376 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAATGACAGACAGACAGGCG -3'
(R):5'- ATGTCTCTACTGTCCAAGGGAG -3'

Sequencing Primer
(F):5'- GCTCAGGAAGAGTGCTCATCTTC -3'
(R):5'- AGAGTCAGGGCCCATGGTC -3'
Posted On2015-02-05