Incidental Mutation 'R3051:Axin1'
ID264965
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission 040560-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3051 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26190125 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 700 (T700A)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421]
Predicted Effect probably benign
Transcript: ENSMUST00000074370
AA Change: T700A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: T700A

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
AA Change: T700A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: T700A

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163421
AA Change: T700A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: T700A

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169268
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik G A X: 89,754,103 V514I probably damaging Het
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Akap6 T C 12: 52,887,033 L436P probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc178 T A 18: 22,135,131 M100L probably benign Het
Ceacam20 T A 7: 19,976,185 V378E probably benign Het
Cwf19l2 G A 9: 3,410,006 R45H probably benign Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Ddr2 T C 1: 169,988,455 K561R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ltf A G 9: 111,024,522 D280G probably benign Het
Nlrc5 A G 8: 94,476,715 E481G probably benign Het
Olfr390 A G 11: 73,787,234 T99A probably benign Het
Pald1 G A 10: 61,346,763 Q412* probably null Het
Ptprd A G 4: 76,100,630 Y649H probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rbfox3 G T 11: 118,502,888 A37D probably damaging Het
Rpa2 A G 4: 132,775,126 probably null Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc6a7 G A 18: 61,009,517 T41M probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Ten1 T C 11: 116,205,730 F70S possibly damaging Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tktl1 A G X: 74,177,404 T39A probably benign Het
Tmem51 A T 4: 142,032,024 Y138N probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Trpm1 G A 7: 64,269,101 E730K probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zfp345 T C 2: 150,474,852 N12D probably benign Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGCTCCTTTAGTAGAGC -3'
(R):5'- ACATGGCTATCTTCCCTGAAGG -3'

Sequencing Primer
(F):5'- TCCTTTAGTAGAGCGTGGACACAC -3'
(R):5'- TGAAGGACCCTCTCTAGGCCTTAG -3'
Posted On2015-02-05