Incidental Mutation 'R3051:Slc6a7'
ID264967
Institutional Source Beutler Lab
Gene Symbol Slc6a7
Ensembl Gene ENSMUSG00000052026
Gene Namesolute carrier family 6 (neurotransmitter transporter, L-proline), member 7
SynonymsProt
MMRRC Submission 040560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R3051 (G1)
Quality Score214
Status Validated
Chromosome18
Chromosomal Location60995381-61014199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61009517 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 41 (T41M)
Ref Sequence ENSEMBL: ENSMUSP00000025520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025520]
Predicted Effect probably damaging
Transcript: ENSMUST00000025520
AA Change: T41M

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025520
Gene: ENSMUSG00000052026
AA Change: T41M

DomainStartEndE-ValueType
Pfam:SNF 37 561 1.2e-231 PFAM
low complexity region 623 634 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-aminobutyric acid (GABA) neurotransmitter gene family and encodes a high-affinity mammalian brain L-proline transporter protein. This transporter protein differs from other sodium-dependent plasma membrane carriers by its pharmacological specificity, kinetic properties, and ionic requirements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik G A X: 89,754,103 V514I probably damaging Het
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Akap6 T C 12: 52,887,033 L436P probably damaging Het
Axin1 A G 17: 26,190,125 T700A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc178 T A 18: 22,135,131 M100L probably benign Het
Ceacam20 T A 7: 19,976,185 V378E probably benign Het
Cwf19l2 G A 9: 3,410,006 R45H probably benign Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Ddr2 T C 1: 169,988,455 K561R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ltf A G 9: 111,024,522 D280G probably benign Het
Nlrc5 A G 8: 94,476,715 E481G probably benign Het
Olfr390 A G 11: 73,787,234 T99A probably benign Het
Pald1 G A 10: 61,346,763 Q412* probably null Het
Ptprd A G 4: 76,100,630 Y649H probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rbfox3 G T 11: 118,502,888 A37D probably damaging Het
Rpa2 A G 4: 132,775,126 probably null Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Ten1 T C 11: 116,205,730 F70S possibly damaging Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tktl1 A G X: 74,177,404 T39A probably benign Het
Tmem51 A T 4: 142,032,024 Y138N probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Trpm1 G A 7: 64,269,101 E730K probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zfp345 T C 2: 150,474,852 N12D probably benign Het
Other mutations in Slc6a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc6a7 APN 18 61001609 missense possibly damaging 0.88
IGL00433:Slc6a7 APN 18 61001291 critical splice donor site probably null
IGL01391:Slc6a7 APN 18 61003310 missense probably damaging 1.00
IGL01476:Slc6a7 APN 18 61005773 missense probably damaging 1.00
IGL02705:Slc6a7 APN 18 61009428 missense probably damaging 1.00
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0147:Slc6a7 UTSW 18 61002111 splice site probably benign
R0267:Slc6a7 UTSW 18 60996711 missense probably benign 0.00
R1349:Slc6a7 UTSW 18 61000543 missense probably benign 0.03
R1498:Slc6a7 UTSW 18 60996692 missense probably benign 0.02
R1874:Slc6a7 UTSW 18 61001398 splice site probably benign
R2005:Slc6a7 UTSW 18 61001641 missense possibly damaging 0.68
R3970:Slc6a7 UTSW 18 61003345 missense possibly damaging 0.94
R4573:Slc6a7 UTSW 18 61002181 missense probably benign 0.20
R4835:Slc6a7 UTSW 18 61002205 missense probably benign 0.04
R4942:Slc6a7 UTSW 18 61004517 missense probably damaging 1.00
R5112:Slc6a7 UTSW 18 61007376 missense probably null 0.04
R5426:Slc6a7 UTSW 18 61003236 splice site probably null
R6168:Slc6a7 UTSW 18 61001662 missense probably benign 0.18
R6312:Slc6a7 UTSW 18 61002385 missense probably benign 0.12
R6489:Slc6a7 UTSW 18 61007543 missense probably damaging 1.00
R7131:Slc6a7 UTSW 18 61002202 missense probably damaging 1.00
R7460:Slc6a7 UTSW 18 61001602 missense probably benign 0.02
R7556:Slc6a7 UTSW 18 61007442 nonsense probably null
R7740:Slc6a7 UTSW 18 61000423 missense possibly damaging 0.90
R7793:Slc6a7 UTSW 18 61005779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCACTCCAAAGGCCATC -3'
(R):5'- TCTTGAGTCCAGGTGAAATCAC -3'

Sequencing Primer
(F):5'- GGTCACTCCAAAGGCCATCCTATAG -3'
(R):5'- TCATCTGAACCTGATGCGAG -3'
Posted On2015-02-05