Incidental Mutation 'I1329:Vmn1r16'
ID26497
Institutional Source Beutler Lab
Gene Symbol Vmn1r16
Ensembl Gene ENSMUSG00000115792
Gene Namevomeronasal 1 receptor 16
SynonymsV1rc29
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location57318052-57329494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57323534 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 34 (R34S)
Ref Sequence ENSEMBL: ENSMUSP00000154643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177267] [ENSMUST00000227168] [ENSMUST00000227283] [ENSMUST00000228356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000177267
AA Change: R34S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134873
Gene: ENSMUSG00000093523
AA Change: R34S

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.4e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227168
AA Change: R34S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227283
AA Change: R34S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000228356
AA Change: R34S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Vmn1r16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vmn1r16 APN 6 57322731 missense possibly damaging 0.74
IGL02027:Vmn1r16 APN 6 57323059 missense possibly damaging 0.49
IGL02804:Vmn1r16 APN 6 57323482 missense probably benign 0.18
IGL03329:Vmn1r16 APN 6 57323618 missense probably damaging 0.99
IGL03392:Vmn1r16 APN 6 57322894 missense probably damaging 1.00
PIT4581001:Vmn1r16 UTSW 6 57322873 missense probably benign 0.12
R0750:Vmn1r16 UTSW 6 57322827 missense probably benign 0.00
R1137:Vmn1r16 UTSW 6 57323236 missense probably damaging 1.00
R1239:Vmn1r16 UTSW 6 57323633 start codon destroyed probably null 1.00
R1796:Vmn1r16 UTSW 6 57323271 missense probably benign 0.03
R1858:Vmn1r16 UTSW 6 57322899 missense probably damaging 1.00
R1895:Vmn1r16 UTSW 6 57322900 missense probably benign 0.31
R1946:Vmn1r16 UTSW 6 57322900 missense probably benign 0.31
R3832:Vmn1r16 UTSW 6 57323227 missense probably benign 0.00
R4801:Vmn1r16 UTSW 6 57323190 missense probably benign 0.03
R4802:Vmn1r16 UTSW 6 57323190 missense probably benign 0.03
R6658:Vmn1r16 UTSW 6 57323106 nonsense probably null
R6981:Vmn1r16 UTSW 6 57323488 missense probably benign 0.30
R6991:Vmn1r16 UTSW 6 57322884 nonsense probably null
X0061:Vmn1r16 UTSW 6 57323364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTGACAGCCTGGACCACAC -3'
(R):5'- ATGGGGACTAACCTGGGAGACATC -3'

Sequencing Primer
(F):5'- TGGACCACACTCAGGAGG -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-04-16