Incidental Mutation 'R3052:Olfr1126'
ID264979
Institutional Source Beutler Lab
Gene Symbol Olfr1126
Ensembl Gene ENSMUSG00000058194
Gene Nameolfactory receptor 1126
SynonymsGA_x6K02T2Q125-48959068-48960012, MOR264-5
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87453962-87458911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87457903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 246 (T246K)
Ref Sequence ENSEMBL: ENSMUSP00000150504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071355] [ENSMUST00000213366]
Predicted Effect probably damaging
Transcript: ENSMUST00000071355
AA Change: T246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071313
Gene: ENSMUSG00000058194
AA Change: T246K

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 8.6e-52 PFAM
Pfam:7tm_1 47 296 8.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213366
AA Change: T246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Olfr1126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1126 APN 2 87457927 missense probably damaging 1.00
IGL01875:Olfr1126 APN 2 87457310 missense probably damaging 0.99
IGL02207:Olfr1126 APN 2 87457450 missense probably benign 0.22
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0478:Olfr1126 UTSW 2 87458026 missense probably damaging 0.99
R1055:Olfr1126 UTSW 2 87457437 small deletion probably benign
R1438:Olfr1126 UTSW 2 87457992 missense probably benign 0.00
R1625:Olfr1126 UTSW 2 87457672 missense probably damaging 1.00
R1912:Olfr1126 UTSW 2 87457383 missense probably damaging 1.00
R4638:Olfr1126 UTSW 2 87457983 missense possibly damaging 0.60
R5102:Olfr1126 UTSW 2 87457794 missense probably benign
R5526:Olfr1126 UTSW 2 87457765 missense probably benign 0.01
R5825:Olfr1126 UTSW 2 87457450 missense probably benign 0.22
R5965:Olfr1126 UTSW 2 87458037 missense probably benign 0.14
R6505:Olfr1126 UTSW 2 87457927 missense probably damaging 1.00
R7494:Olfr1126 UTSW 2 87457568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTCCCATTCTCAAGCTGG -3'
(R):5'- GTAGCTGAGTAAGAAGCAATCAATC -3'

Sequencing Primer
(F):5'- CTGGCCTGTGGAGATACTTCAATAC -3'
(R):5'- GTAACAGTTTTCTCAGTGCAGC -3'
Posted On2015-02-05