Incidental Mutation 'R3052:Mfsd2a'
ID264984
Institutional Source Beutler Lab
Gene Symbol Mfsd2a
Ensembl Gene ENSMUSG00000028655
Gene Namemajor facilitator superfamily domain containing 2A
Synonyms1700018O18Rik, Mfsd2
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location122946850-122961188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122951842 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 172 (L172P)
Ref Sequence ENSEMBL: ENSMUSP00000030408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030408] [ENSMUST00000127047]
Predicted Effect probably damaging
Transcript: ENSMUST00000030408
AA Change: L172P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030408
Gene: ENSMUSG00000028655
AA Change: L172P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
Pfam:MFS_2 44 500 1.7e-96 PFAM
Pfam:MFS_1 57 450 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127047
SMART Domains Protein: ENSMUSP00000116782
Gene: ENSMUSG00000028655

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:MFS_2 42 106 2.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152308
Meta Mutation Damage Score 0.9297 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show partial postnatal lethality, reduced body weight, ataxia, and alterations in lipid metabolism and photoreceptor cell development. Homozygotes for a different null allele show a leaky blood-brain barrier and increased CNS-endothelial-cell vesicular transcytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Mfsd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Mfsd2a APN 4 122949307 missense probably benign 0.32
IGL02756:Mfsd2a APN 4 122948539 missense probably benign 0.30
azure UTSW 4 122952021 missense possibly damaging 0.66
R0355:Mfsd2a UTSW 4 122951839 missense possibly damaging 0.64
R0394:Mfsd2a UTSW 4 122950168 missense probably benign 0.26
R2002:Mfsd2a UTSW 4 122956816 missense probably damaging 1.00
R2516:Mfsd2a UTSW 4 122950487 missense probably damaging 1.00
R2943:Mfsd2a UTSW 4 122948589 missense possibly damaging 0.87
R4811:Mfsd2a UTSW 4 122959382 missense probably benign 0.28
R4977:Mfsd2a UTSW 4 122950509 missense probably benign
R5030:Mfsd2a UTSW 4 122950156 missense possibly damaging 0.90
R5231:Mfsd2a UTSW 4 122959301 missense possibly damaging 0.88
R5735:Mfsd2a UTSW 4 122949327 missense probably damaging 0.98
R6173:Mfsd2a UTSW 4 122951246 missense probably benign
R6321:Mfsd2a UTSW 4 122949372 missense probably benign 0.06
R6433:Mfsd2a UTSW 4 122950457 missense probably benign 0.01
R6736:Mfsd2a UTSW 4 122951261 missense probably benign
R6793:Mfsd2a UTSW 4 122950705 missense probably benign 0.02
R7073:Mfsd2a UTSW 4 122951295 missense possibly damaging 0.91
R7255:Mfsd2a UTSW 4 122952021 missense possibly damaging 0.66
R7382:Mfsd2a UTSW 4 122952123 missense possibly damaging 0.53
R7868:Mfsd2a UTSW 4 122956855 missense possibly damaging 0.93
R7951:Mfsd2a UTSW 4 122956855 missense possibly damaging 0.93
Z1176:Mfsd2a UTSW 4 122951839 missense probably benign 0.44
Z1176:Mfsd2a UTSW 4 122959311 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGGCAGTTGACATTTCAGCC -3'
(R):5'- TTTGAGACACTGGTCACGG -3'

Sequencing Primer
(F):5'- TGCTTGACAGACACAAGGCTCTAG -3'
(R):5'- CATGCATCTAACCAGCTG -3'
Posted On2015-02-05