Incidental Mutation 'R3052:Cyp2a5'
ID264987
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 5
SynonymsCoh
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26835305-26843548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26842985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 471 (I471V)
Ref Sequence ENSEMBL: ENSMUSP00000005685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005685
AA Change: I471V

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547
AA Change: I471V

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165641
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169007
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect silent
Transcript: ENSMUST00000170631
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26837103 missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26841009 missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26843046 missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26835874 missense probably damaging 0.99
PIT4696001:Cyp2a5 UTSW 7 26840979 missense probably benign 0.18
R0762:Cyp2a5 UTSW 7 26838873 nonsense probably null
R0980:Cyp2a5 UTSW 7 26839006 unclassified probably null
R1078:Cyp2a5 UTSW 7 26835541 missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26835936 missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26841876 intron probably benign
R1803:Cyp2a5 UTSW 7 26835546 splice site probably null
R1899:Cyp2a5 UTSW 7 26839033 nonsense probably null
R1977:Cyp2a5 UTSW 7 26835922 missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26840475 missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26837103 missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26841054 missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26835545 critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26841104 missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26835874 missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26842958 missense probably benign 0.09
R5998:Cyp2a5 UTSW 7 26837153 missense probably benign 0.00
R6186:Cyp2a5 UTSW 7 26843388 unclassified probably benign
R7338:Cyp2a5 UTSW 7 26842947 missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26836783 missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26840478 missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26837118 missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
R7914:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
Z1088:Cyp2a5 UTSW 7 26841107 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26835497 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26836774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGGGATTAGAGCTTTCC -3'
(R):5'- ATATCCTCTGCAAGTCTACTCTGTG -3'

Sequencing Primer
(F):5'- CTCAGGGATTAGAGCTTTCCTTAAAG -3'
(R):5'- GCAAGTCTACTCTGTGTCCTCTG -3'
Posted On2015-02-05