Incidental Mutation 'I1329:4931406P16Rik'
ID26499
Institutional Source Beutler Lab
Gene Symbol 4931406P16Rik
Ensembl Gene ENSMUSG00000066571
Gene NameRIKEN cDNA 4931406P16 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location34236707-34313551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34245194 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 542 (S542P)
Ref Sequence ENSEMBL: ENSMUSP00000145762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]
Predicted Effect probably benign
Transcript: ENSMUST00000085592
AA Change: S754P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: S754P

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108074
AA Change: S754P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: S754P

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127010
Predicted Effect probably benign
Transcript: ENSMUST00000205264
AA Change: S38P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206245
Predicted Effect probably benign
Transcript: ENSMUST00000206399
AA Change: S542P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in 4931406P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:4931406P16Rik APN 7 34245987 splice site probably benign
IGL00160:4931406P16Rik APN 7 34239006 missense possibly damaging 0.88
IGL00691:4931406P16Rik APN 7 34245485 missense probably damaging 1.00
IGL01312:4931406P16Rik APN 7 34256508 missense probably benign 0.19
IGL01954:4931406P16Rik APN 7 34245035 missense probably damaging 1.00
IGL02016:4931406P16Rik APN 7 34239101 missense possibly damaging 0.74
IGL02390:4931406P16Rik APN 7 34248218 missense probably damaging 1.00
IGL02407:4931406P16Rik APN 7 34256484 missense probably damaging 0.99
IGL02677:4931406P16Rik APN 7 34242409 splice site probably benign
IGL02929:4931406P16Rik APN 7 34245082 missense possibly damaging 0.46
IGL03285:4931406P16Rik APN 7 34284991 missense possibly damaging 0.81
R0004:4931406P16Rik UTSW 7 34256428 missense probably damaging 0.99
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0135:4931406P16Rik UTSW 7 34245957 missense probably damaging 1.00
R0137:4931406P16Rik UTSW 7 34239219 missense probably damaging 1.00
R0556:4931406P16Rik UTSW 7 34239797 missense probably damaging 0.99
R0687:4931406P16Rik UTSW 7 34245418 missense possibly damaging 0.95
R0928:4931406P16Rik UTSW 7 34248246 splice site probably null
R1719:4931406P16Rik UTSW 7 34248206 missense probably damaging 0.98
R1908:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1909:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1976:4931406P16Rik UTSW 7 34257380 missense probably damaging 0.99
R2496:4931406P16Rik UTSW 7 34256491 missense possibly damaging 0.93
R3005:4931406P16Rik UTSW 7 34284784 missense probably damaging 1.00
R4666:4931406P16Rik UTSW 7 34284773 missense probably damaging 0.98
R4832:4931406P16Rik UTSW 7 34238908 utr 3 prime probably benign
R4870:4931406P16Rik UTSW 7 34284887 missense possibly damaging 0.83
R4989:4931406P16Rik UTSW 7 34245800 missense probably damaging 1.00
R5033:4931406P16Rik UTSW 7 34245812 missense probably benign
R5308:4931406P16Rik UTSW 7 34245755 nonsense probably null
R5366:4931406P16Rik UTSW 7 34242288 missense possibly damaging 0.74
R5386:4931406P16Rik UTSW 7 34242388 missense probably damaging 0.99
R5688:4931406P16Rik UTSW 7 34253991 missense possibly damaging 0.74
R5688:4931406P16Rik UTSW 7 34284709 missense probably damaging 0.99
R5714:4931406P16Rik UTSW 7 34240516 nonsense probably null
R5733:4931406P16Rik UTSW 7 34245080 missense probably damaging 0.99
R5772:4931406P16Rik UTSW 7 34253988 missense probably damaging 0.97
R6059:4931406P16Rik UTSW 7 34245463 missense possibly damaging 0.90
R6211:4931406P16Rik UTSW 7 34239004 missense possibly damaging 0.95
R6276:4931406P16Rik UTSW 7 34242377 nonsense probably null
R6477:4931406P16Rik UTSW 7 34257630 critical splice donor site probably null
R6757:4931406P16Rik UTSW 7 34239077 missense possibly damaging 0.89
R6912:4931406P16Rik UTSW 7 34245668 missense probably benign
R7156:4931406P16Rik UTSW 7 34245708 missense possibly damaging 0.80
R7317:4931406P16Rik UTSW 7 34263647 missense probably benign
R7431:4931406P16Rik UTSW 7 34284794 missense possibly damaging 0.73
R7452:4931406P16Rik UTSW 7 34245671 missense probably benign
R7996:4931406P16Rik UTSW 7 34263599 missense possibly damaging 0.77
RF019:4931406P16Rik UTSW 7 34240549 missense probably damaging 0.98
X0021:4931406P16Rik UTSW 7 34245363 missense possibly damaging 0.94
Z1177:4931406P16Rik UTSW 7 34284755 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCCATCACTTTGGTCACGGTTTG -3'
(R):5'- AAGGCGTAACTCTACTGCCACTGC -3'

Sequencing Primer
(F):5'- GGCCAGGTGTTATTTCTAGGTCC -3'
(R):5'- AGCCATCACTGCCATTGG -3'
Posted On2013-04-16